РазноеАльфа гбо настройка: Альфа ГБО — настройка, история, отличия от конкурентов и цены на продукцию

Альфа гбо настройка: Альфа ГБО — настройка, история, отличия от конкурентов и цены на продукцию

Содержание

Альфа ГБО - настройка, история, отличия от конкурентов и цены на продукцию

Содержание:

  1. ГБО Альфа
  2. Немного истории оборудования Alpha
  3. Настройка ГИС Alpha
  4. Преимущества и отличия нашего оборудования и компании перед конкурентами

ГБО Альфа

ГБО Alpha — прекрасная возможность и сэкономить деньги на топливе, и быть уверенным в надежности установки системы с сохранением безопасности, комфорта и легкого хода (как на бензине).

Alpha — современное отечественное оборудование, которое соответствует всем стандартам качества и имеет сертификат соответствия, с возможностью программы к «самообучению» по управлению ГБО автомобиля. Ранее это было присуще исключительно автомобильным программам, работающим на бензине. Наше оборудование ГБО Альфа, инжекторная система распределенного впрыска газа в цилиндры, пользуется спросом и доверием более 200 крупных клиентов по всей стране и является единственной и самой популярной системы подобного класса отечественной разработки.

Управление ГБО Альфа полностью электронное, на сегодняшний день мы предлагаем лучшее программное обеспечение.

Немного истории оборудования Alpha

Мы являемся прямыми производители газобаллонного оборудования высокого качества. Наша компания прошла долгий путь перед тем как стать одним из лидеров рынка.

В 2006 году была создана первая пробная партия газовой инжекторной системы с прицелом на отечественные реалии (качество топливо, автопарк и т.д.), затем, через год она вышла на рынок. Постепенно мы стали совершенствовать дизайн и внедрять самые современные компоненты последних поколений.

Через некоторое время мы разделили нашу продукцию на несколько линеек, чтобы она была доступна клиентам с разными финансовыми возможностями (например, эконом-версией в виде комплектов Alpha S-4 или стандарт, бизнес или премиум комплекты).

В 2013 году мы обновили электронику у всей линейки Альфа, что привело к еще большей надежности и востребованности среди покупателей. 2015 год ознаменовался выпуском программного обеспечения MS-015, которое позволяет использовать электронику ГБО в полную силу.

Из наших последних новостей: разработана абсолютно новая линейка ALPHA PM (при сотрудничестве с TEGAS engeneering).

Мы скоро будем готовы предложить вашему вниманию прошивка MS-017, которая позволяет работать с новыми газовыми инжекторами повышенной производительности.

Настройка ГИС Alpha

Также на нашем сайте вы можете найти и скачать инструкции по установке ALPHA AEB MP32, ALPHA AEB MP48, ALPHA AEB MP48 OBD, ALPHA AEB MP2568, а также подробное описание калибровочного программного обеспечения газовой инжекторной системы (пошаговая подробная инструкция для установщика). В этой инструкции вы увидите подробные описания требований к компьютеру, с помощью которого будет происходить подключение и настройка системы (в том числе программного обеспечения и т.п.).

Настройка клапанов и всех электронных приборов — все это подробно приведено в данной инструкции. В том числе, как действовать вручную, в случае невозможности выставления параметров автоматически. Большим преимуществом именно этой программы настройки является возможность загружать обновления.

Преимущества и отличия нашего оборудования и компании перед конкурентами

  • Новое семейство инжекторных систем Alpha обладает настолько широким набором инноваций и опций, что это позволяет уверенно утверждать: перед нами новая категория систем газового впрыска 4-го поколения.
  • Корпус из углепластика с брызгозащищенными центральными разъемами.
  • Температурный диапазон работы ЭБУ: – 40 — + 100 °С.
  • Диапазон рабочих напряжений ЭБУ: 10,5 — 15,5 В.
  • Система безопасности по наличию утечек газа и потери давления в рабочей магистрали и система диагностики неисправностей элементов системы.
  • Более 15 лет на российском рынке ГБО.
  • Более 1500 клиентов доверяют нам.
  • Официальные представители брендов Lovato, Tomasetto, Atiker, Semperit.
  • 12 складов по всей стране.
  • ГИС Alpha — единственная отечественная разработка подобного класса.
  • Мы поможем организовать оформление вашего автомобиля с ГБО в ГИБДД.
  • 3 установочных центра в Москве.
  • Установим оборудование и проведем настройку.
  • Проводим регулярные бесплатные выездные семинары, посвященные ГИС Alpha.

Отдельно хотелось бы отметить, что наше оборудование готово исправно работать на российском топливе (ни для кого не секрет, что качество и бензина, и газа в нашей стране порой оставляет желать лучшего).

Альфа ГБО проста в эксплуатации и имеет функцию самодиагностики. Если что-то пошло не так, то система ГБО оповещает об этом водителя. Также она сама мониторит (если, конечно, все настройки выставлены верно, о чем мы поговорим ниже) общее состояние оборудования и выбирает оптимальный режим на данный момент, в зависимости от качества топлива, условий окружающей среды (что особенно актуально в нашей стране) и т.  д.

Ознакомиться с ценами и заказать подходящий именно вашему автомобилю комплект ГБО Alpha вы можете на нашем сайте в интернет-магазине.

«Альфа Газ Центр» Установка ГБО Нижний Новгород

КАК ПРАВИЛЬНО ВЫБРАТЬ ГБО?

Выбор комплекта ГБО, может оказаться сложной задачей без необходимых знаний. Для начала уточним технические характеристики Вашего автомобиля. Нам понадобиться знать объем и тип двигателя, время впрыска бензинового топлива. При выборе комплекта ГБО обязательно стоит учесть и погодные условия, в которых он будет служить, а так же количество газовых заправок в регионе. Верно принятое решение поможет в дальнейшем упростить и удешевить использование и обслуживание ГБО. Перед приобретением и установкой ГБО комплекта рекомендуем Вам проконсультироваться в «Альфа Газ Центре».

Пройдём по основным компонентам комплекта ГБО:

Редуктор. Основной критерий выбора редуктора это мощность двигателя. Выбирать редуктор необходимо с запасом мощности 20 – 30%. Для автомобилей мощностью более 300 -400 л.с. может потребоваться установка двух редукторов.

Выбор рейки (форсунок). Рейку необходимо подбирать в зависимости от мощности, количества цилиндров и конфигурации двигателя (рядный, V – образный, оппозитный), а так же времени впрыска бензинового или дизельного топлива.

Контроллер (электроника). Выбор контроллера зависит, прежде всего, от года выпуска автомобиля и типа двигателя. Например, если двигатель имеет систему самодиагностики (OBD II, EOBD), необходимо подобрать более современные типы контроллера, которые работают совместно с системой самодиагностики двигателя.

Баллон. Баллоны различаются по типу газа, а так же объемом, размером и формой. Болоны для пропана бывают тороидальные и цилиндрические, для наружной и внутренней установки. Как правило, тороидальный баллон для установки внутри автомобиля выбирают с внутренней горловиной, для снаружи автомобиля с внешней горловиной.

Запорная арматура (мультиклапан и закрывающие устройства). Зависит от выбора типа баллона (цилиндрический или тороидальный), его размера, горловиной (внутренняя или внешняя) и диаметра магистральной трубы (6 или 8 мм.), новинка представлена с предохранительным электроклапаном который при аварийной ситуации перекроет газ в баллоне.

Отличия ГБО: сильные и слабые стороны оборудования популярных производителей

Какой бренд ГБО выбрать?

Вопрос, какой бренд ГБО выбрать, возникает у каждого, кто задумывается об установке газа на автомобиль. На рынке сегодня достаточно много производителей газового оборудования, каждый из них применяет собственные технологии при разработке ГБО и учитывает множество факторов, влияющих на качество оборудования.

На сегодняшний день производителей газового оборудования великое множество. Мы предлагаем нашим клиентам для установки оборудование брендов Alpha, Digitronic, Lovato, OMVL и BRC. Нам часто задают вопрос: какое оборудование лучше и что будет хорошо работать на конкретном автомобиле.

Мы просмотрели множество статей, форумов и отзывов в интернете и увидели много устаревшей информации. Рынок ГБО постоянно меняется, производители работают над ошибками и улучшают свое оборудование, устраняя его недостатки. Мы уже более 20 лет работаем с ГБО и, основываясь на своем опыте и опыте наших коллег, решили создать свежий материал, где собрали сильные и слабые стороны оборудования тех брендов, с которыми мы работаем, чтобы нашим клиентам было проще определиться с выбором.

Андрей Фролов, технический директор «Газсервис»


Основные характеристики оборудования

  • Оборудование «Alpha»

    ГБО Alpha — оборудование 4 поколения, которое отвечает всем современным требованиям безопасности. Комплектующие разработаны в Италии. Программное обеспечение — полностью отечественного производства, что позволяет оборудованию отлично работать в самых разных климатических условиях и подстраиваться под разное качество топлива.

    Alpha —инжекторная система распределенного впрыска газа в цилиндры, пользующаяся спросом и доверием более 200 установщиков по всей стране и являющаяся единственной и самой популярной системой отечественной разработки подобного класса.

    • Alpha S, M

      Данный вид ГБО является Российской разработкой с инновационной системой пересчета топливных данных автомобиля. Аналогов данной системы пока нет. Очень хорошо работает практически со всеми автомобилями, не исключая турбо-моторы, а также автомобили с изменяемыми впрысками топлива. Блоки Alpha M поддерживают работу с моторами вальвотроник.

      • Программное обеспечение
        ПО — собственная разработка компании с простым и понятным интерфейсом. Существует очень удобный калькулятор для правильного подбора настроек оборудования для конкретного автомобиля. Очень широкий ассортимент дополнительных функций. Имеется индикатор кодов неисправностей системы, который выводит код на переключатель. При знании программного обеспечения очень просто и быстро определять неисправности автомобиля.
      • Блок управления
        Блок управления исполнен в пластиковом, не влагозащищенном корпусе. Разъемы и провода системы хорошего качества.
      • Редукторы
        Оборудование оснащается газовыми редукторами Tomasetto, отличающимися практичностью и надежностью. Данные редукторы имеют широкую линейку мощностных характеристик и полностью ремонтопригодны.
      • Рампы
        Оборудование комплектуется рампами всех известных брендов. Подбор рампы производится в индивидуальном порядке, исходя из особенностей автомобиля. В большинстве это полностью обслуживаемые рампы, их надежность полностью зависит от условий эксплуатации.
      • Комплектующие
        Комплекты поставляются с любыми комплектующими, в первую очередь это компоненты итальянского производства (такие бренды как Lovato, Tomasetto, Reil, Valtek и OMVL). Таким образом можно собрать самую подходящую комплектацию на любой автомобиль.
      • Обслуживание
        Стоимость ТО сравнима с обслуживанием других видов оборудования. Первое ТО обходится в сумму около 400 р., второе — в районе 850 р. В постгарантийный период обслуживание не принесет сюрпризов, стоимость запасных частей вполне доступна.
    • Alpha D

      Данное ГБО является полностью восстановленным STAG 300, которое на данный момент снято с производства в Польше. Данный комплект будет корректно работать на самых простых автомобилях, не привередливых к составу смеси. Например на автомобилях Газель, Лада и тому подобных.

      • Программное обеспечение
        ПО — копия STAG или Digitroniс. Интерфейс прост и удобен, сложностей с настройкой ГБО не возникает, но требует внимательного отношения. По диагностике неисправностей автомобиля потенциал небольшой. Подключения к OBD не имеет.
      • Блок управления
        Корпус ЭБУ выполнен в дюралевом влагозащищенном корпусе среднего размера, также обладает герметичным электрическим разъемом.
      • Комплектующие
        Комплект поставляется с теми же комплектующими, что и Alpha S, что позволяет собрать любую комплектацию на автомобиль.
      • Обслуживание
        Оборудование так же доступно в обслуживании. Первое ТО — 400 р., второе — 850 р. Комплект полностью ремонтопригоден и комплектующие находятся в доступной ценовой категории.
  • Оборудование Digitronic

    Линейка ГБО, разработанная инженерами Digitronic, производится в Европе. Высококачественная электроника изготавливается на итальянском заводе фирмы АЕВ. Имеет широкий ассортимент блоков управления, а также расширенный функционал. Данное оборудование подразделяется на Maxi 2, IQ и MP 32, которые достаточно корректно работают с большинством автомобилей.

    • Программное обеспечение
      ПО — совместная разработка Италии и Польши, доработанная программа старого оборудования Digitronic. Такое же ПО установлено и в более дорогих комплектах, таких как IQ и МР. Программное обеспечение удобно в использовании, регистратор ошибок позволяет определять неисправности автомобиля, не связанные с газовой системой.
      Maxi 2 не имеет функции поддержки OBD. IQ обладает поддержкой связи с OBD и дает возможность корректировки топливовоздушной смеси, отталкиваясь от коррекций ЭБУ автомобиля, плюс ко всему это возможность просмотра параметров автомобиля, чтения и удаления его ошибок.
    • Блок управления
      Блоки управления выполнены в пластиковом влагозащищенном корпусе. Обладают герметичными электрическими разъемами и проводкой хорошего качества.
    • Редукторы
      Используются редукторы Tomasetto, EMER Palladio, КМЕ и многие другие. Все эти редукторы полностью ремонтопригодны и отличаются отличным качеством.
    • Рампы
      Используются топливные рампы итальянских производителей таких брендов как АЕВ, Valtek, Dymko, Ctag. Данные рампы обладают высокой надежностью, они вполне ремонтопригодны и обслуживаемы.
    • Комплектующие
      Как и оборудование Alpha, Digitronic оснащается всеми возможными комплектующими.
    • Обслуживание
      Стоимость техобслуживания одинакова с ГО Alpha: первое ТО — 400 р., второе — 850 р. Стоимость ремонта полностью зависит от комплектации системы: ЭБУ, редуктора, рампы.
  • Оборудование Lovato

    Lovato — оборудование чисто итальянского изготовления, одним из первых появившееся на российском рынке более 20 лет назад. Компания имеет собственное производство полностью всех комплектующих системы, что говорит о его качестве и надежности. Комплекты имеют разные комплектующие, подразделяются они по ценовой категории, а также по способности качественно отработать различные типы автомобилей. Комплекты Lovato будут работать практически со всеми авто, все зависит от комплектации системы и ее стоимости. Однако, неправильный подбор может привести к некорректной работе системы.

    • Программное обеспечение
      ПО — собственная разработка компании, достаточно простое, но не совсем удобное в использовании. Алгоритмы пересчета коэффициентов топлива достаточно верны, но требуют обкатки. Выявление неисправностей автомобиля, не связанных с ГБО, затруднительно. OBD контроль имеется только в премиум-версии и дает хороший результат коррекции топлива, эмуляции датчиков давления топлива, а также тушение ошибок ДВС по выбору.
    • Блок управления
      Исполнение ЭБУ очень достойное: присутствует пыле- и влагозащита, блок выполнен в пластиковом корпусе с герметичным разъемом. Электрические разъемы и электропроводка хорошего качества.
    • Редукторы
      Редукторы Lovato надежны, но имеют недостаточный прогрев топлива в российских условиях эксплуатации, что тянет за собой быстрый износ топливной рампы. Ремонт редукторов возможен, но из-за стоимости ремкомплектов является достаточно дорогостоящим.
    • Рампы
      Топливные рампы JLP очень надежны, но имеют очень низкую производительность. Рампы типа LP либо KP имеют более высокую производительность, но и меньшую надежность. Все рампы Lovato неремонтопригодны.
    • Комплектующие
      Комплекты имеют очень широкий спектр запчастей, все зависит от автомобиля, на который будет монтироваться комплект.
    • Обслуживание
      Стоимость ТО, как и у других брендов — 400 р. и 850 р. Стоимость постгарантийного обслуживания очень высока. Стоимость запасных частей также достаточно высока. Ремонт топливной рампы невозможен, только замена.
  • Оборудование OMVL

    OMVL — газовое оборудование итальянского изготовления, имеет собственное производство компонентов ГБО. Оборудование надежно и устойчиво к резким колебаниям температуры. OMVL поставляется на многие заводы производителей авто. Партнерами «OMVL» являются Группа ГАЗ (Россия), General Motors (США), Volkswagen (Германия), Fiat (Италия), PSA Peugeot-Citroen (Франция), Кларк (США) и др. Система будет достойно работать практически со всеми автомобилями, все будет зависеть от грамотного подбора комплекта.

    • Программное обеспечение
      Программное обеспечение достаточно простое и удобное, работа с ним не составит особых проблем. Диагностировать неисправности автомобиля, не связанные с системой ГБО, не очень удобно, и программа не обладает потенциалом в этой области.
      Подключения к OBD не имеет, но более свежие и дорогие комплекты обладают данной функцией, что дает более четкую настройку системы, а также возможность чтения и тушения ошибок ЭБУ.
    • Блок управления
      Корпусы ЭБУ имеют различное исполнение, более старшие блоки имели алюминиевый некомпактный корпус. В последствии блок обрел пластиковый корпус и стал более компактным. Все версии блоков обладают герметичностью и одинаковыми разъемами.
    • Редукторы
      Редукторы OMVL имеют широкий диапазон мощностных характеристик. Конструкция достаточно сложная, но надежная. Редукторы очень надежные и ремонтопригодные, с запасными частями проблем не возникает.
    • Рампы
      Топливные рампы производительные и скоростные. Обладают высокой надежностью и ремонтопригодностью. Существенный минус у этой топливной системы — это нерегулируемая система плунжеров.
    • Комплектующие
      Комплекты производятся как стандартные, так и с возможностью индивидуального подбора. Все комплектующие OMVL только собственного производства.
    • Обслуживание
      Стоимость ТО не отличается от остальных систем. В среднем первое ТО — 400 р., второе — 850 р. Стоимость запасных частей немного высока, особенно электронных компонентов.
  • Оборудование BRC

    BRC один из самых крупных производителей ГБО в мире. Оборудование также представляет семейство чистокровных итальянцев, имеющих собственное производство электронных компонентов и всех механических элементов системы. Производитель представляет брендовый сегмент ГБО.

    • Программное обеспечение
      Старший предшественник программного обеспечения Sequent Plug & Drive был не совсем удобен в использовании, настройка системы занимала достаточно долгое время, а также требовала дополнительных настроек в движении автомобиля. Диагностировать неисправности автомобиля, не связанные с неисправностями ГБО, было неудобно.
      Но появился более удобный и простой Calibration tool с блоками Sequent 32, обладающими очень широким потенциалом в настройках и обращении. Все блоки Sequent 32 обладают поддержкой OBD, что дает возможность системе корректировать топливовоздушную смесь, непосредственно отталкиваясь от коррекций ЭБУ автомобиля. Кроме того, это дает возможность просматривать параметры автомобиля, читать и удалять его ошибки. Также есть возможность автоматического удаления необходимых кодов.
    • Блок управления
      Блоки управления выполнены в пластиковом влагозащищенном корпусе. Обладает герметичными электрическими разъемами и проводами хорошего качества.
    • Редукторы
      Используются редукторы BRC Genius MB 1200, Genius MB 1500 и Genius Max. Они разделяются по своей мощности и производительности. Обладают высокой надежностью и ремонтопригодностью.
    • Рампы
      Топливные рампы используются также BRC, подразделяются на два типа: мембранные и плунжерного типа.
      Мембранные форсунки очень скорострельные, но делятся на три типа по производительности, что неудобно при подборе комплектующих. Форсунки не ремонтируются, не обслуживаются, очень дорогостоящи и прихотливы к качеству топлива.
      Плунжерные форсунки BRC Alba имеют более простое строение, они разборные и подлежат ремонту. Менее прихотливы к топливу, более дешевые, но уступают по скорости более дорогостоящим рампам.
    • Комплектующие
      Комплекты поставляются только с компонентами системы BRC, которые имеют достаточно высокую стоимость.
    • Обслуживание
      ТО лучше проводить с заменой сразу всех фильтрующих элементов, чтобы продлить жизнь топливной системы. Стоимость постгарантийного обслуживания и ремонта совсем не бюджетная.

Каждое из устанавливаемых нами видов оборудования имеет свои достоинства и недостатки. Мы работаем только с проверенными производителями и постоянно отслеживаем особенности эксплуатации каждого установленного комплекта, чтобы подбирать самое подходящее ГБО для автомобилей.

В установочном центре «Газсервис» подбор оборудования индивидуален для каждого авто и основывается на характеристиках конкретного автомобиля и пожеланиях владельца. Мы стремимся сделать эксплуатацию ГБО простой и приятной для каждого нашего клиента.

ALPHA - инсталяторы, программы, прошивки, руководство

НОВОЕ СЕМЕЙСТВО ГАЗОВЫХ ИНЖЕКТОРНЫХ СИСТЕМ «Alpha» обладает настолько широким набором инноваций и опций, что это позволяет уверенно утверждать: перед нами новая категория систем газового впрыска 4-го поколения.

«Alpha-M»: СЕРТИФИКАТ

ИНСТАЛЛЯТОР И ПРОШИВКИ ALPHA

ПРОГРАММА:

НОВЫЙ ИНСТАЛЛЯТОР ALPHA TUNER (выпуск 12.11.12)

Новый инсталлятор AlphaTuner 12.11.12 с прошивкой MS-012 для систем ALPHA S1 и ALPHA M1. Программа поддерживает работу с блоками ALPHA M и ALPHA S предыдущих версий. При установке программы вся библиотека прошивок, которыми вы пользовались, и библиотека клиентской базы автоматически сохраняются в новой программе.

ИНСТАЛЛЯТОР ALPHA TUNER (выпуск 02-2012)

Инсталлятор ALPHA TUNER (выпуск 02-2012) содержит улучшенный интерфейс установления связи «блок-компьютер», автоматическую систему поиска СОМ-порта который задействован в подключении и систему автопоиска блока подключенного к компьютеру. Инсталлятор содержит необходимые драйверы USB шнура и USB ключа для различных операционных систем, улучшенный интерфейс работы с накоплением, хранением и восстановлением данных полученных при работе с блоком управления.
Новая прошивка MS 010 рекомендуется для апгрейда блоков управления с более ранними версиями прошивок. В прошивке появилась возможность использования инжекторов OMVL и LOVATO KP. Появилась закладка «ДОПОЛНИТЕЛЬНО» в которой имеется 3 подзакладки:
• VALVETRONIC – работа с двигателями без МАР
• Два KG-работа с турбированными, форсированными и тюнинговыми двигателями
• ТЕРМОКОРРЕКЦИЯ - дополнительная корректировка впрыска в зависимости от температуры газа (используется во время прогрева двигателя).
В закладке «СТАТИСТИКА» появилась возможность заблокировать «несанкционированный» доступ к изменению параметров блока путём применения «PIN-кода».
В закладке "ОБОРУДОВАНИЕ"/"ДАТЧИК УРОВНЯ ТОПЛИВА", появилась возможность использовать "ВИРТУАЛЬНЫЙ ДАТЧИК". Это система математического расчёта уровня топлива работает БЕЗ каких либо электро-механических датчиков.

ИНСТАЛЛЯТОР ДЛЯ СИСТЕМ «Alpha-M» и «Alpha-S» EGS Tuner 135_4 с прошивкой MS_004


• setup_egs_tuner_pb135_4.exe [11.43 Mb] - пакет установки для операционных систем Windows XP, Windows Vista и Windows 7


• setup_egs_tuner_pb135_4_x64.exe [11.64 Mb] (cкачиваний: 1114) - пакет установки для 64-х битных версий операционных систем Windows XP, Windows Vista и Windows 7


Новые возможности прошивки MS_004
1. Возможность аварийной работы без датчиков:
• температуры редуктора
• температуры потока газа
• датчика давления
• датчика разряжения МАР
Для активации аварийной работы с вышедшим из строя датчиком, необходимо заглушить двигатель и произвести аварийный запуск двигателя на газе (процедура подробно описана в мануале системы).
2. Автоматическое изменение параметра минимального времени впрыска (Тmin) при выборе типа форсунок.
3. Исключена настроечная таблица инжекторов Table1, в дальнейшей работе по умолчанию используется настроечная таблица Table 2 с уменьшенным ходом якоря.
4. Добавлена таблица коррекции «холодной работы» на газе, позволяющей при необходимости очень точно скорректировать подачу газа в режимах «холодного» и «полупрогретого» двигателя.

ПРОШИВКИ:
Внимание: перед использованием, прошивки необходимо извлечь из архива

ПОРЯДОК УСТАНОВКИ ПРОГРАММЫ:
Poryadok.pdf [326.08 Kb]

ДРАЙВЕР КАБЕЛЯ СВЯЗИ:
В текущую эксплуатацию оборудования проекта «Alpha-M» вводится кабель связи "компьютер - блок управления" со стыком типа USB.
Драйвер для использования данного жгута cdm20600.exe CDM20600.exe [2.24 Mb]

РУКОВОДСТВО

ВИДЕОУЧЕБНИК 14 ВИДЕО РОЛИКОВ ОБУЧАЮЩИХ РАБОТЕ С ПРОГРАММОЙ

ОБЩИЕ ТРЕБОВАНИЯ:
Trebovania.pdf [57.67 Kb]

ИНСТРУКЦИЯ ПО МОНТАЖУ И НАСТРОЙКЕ «Alpha-M», «Alpha-S»:
MANUAL_ALFA_М-S.pdf [9.22 Mb] 

«Alpha-M»: СХЕМЫ ПОДКЛЮЧЕНИЯ И РАСШИФРОВКА КОДОВ ОШИБОК:
Alpha-M.pdf [2.58 Mb] 

«Alpha-S»: СХЕМА ПОДКЛЮЧЕНИЯ НА 2-3-4 ЦИЛИНДРОВЫЙ ДВИГАТЕЛЬ
Shema_Alpha-S.jpg [136.76 Kb]

Ремонт и обслуживание ГБО в Тюмени, доступные цены

Мультиклапан 2000

ВЗУ 1000

Ремкомплект редуктора 1500

Магистраль 1 м.п. 250

Пластик 1 м.п. 200

Фитинг пластик шт. 300

Редуктор Аляска-Полетрон 1200 4000

Полетрон 1500 6000

Газовый клапан 6 мм 1200

Газовый клапан 8 мм 2000

Смеситель антихлоп 600

Вариатор опережения 7500

Форсунка BRC 3800

Диагностика 500

Продув магистрали 300

ТО 1200

Ремкомплект форс VALTEK 1шт 250

Ремкомплект форсунок LOVATO J 1650

Ремкомплект форсунок Lovato K 2000

Кнопка 2-е поколение 800

Эмулятор форсунок 4 цил 1000

Шланг п.м мин. 300

Хомут тосол 30

Кнопка 4 поколение 2000

Мап сенсор альфа 2500-3500

Электрика 1 час 1000

Демонтаж гбо 4 цил. 3000

Демонтаж гбо 6 цил. 4500

Демонтаж гбо 8 цил. 5000

Установка гбо б.у. 4 цил. 10000

Установка гбо б.у. 6 цил. 13000

Установка гбо б.у. 8 цил. 15000

Настройка гбо 2 поколение 300

Настройка газовой карты 4 пок. 800

Тройник тосол 300

Винт дозатор 2-е поколение 300

Резинка антихлоп 100

ВЗУ в люк 2000

Форсунки 4100

Форсунки OMVL 4100

Форсунки VALTEK 3500

Форсунки RAIL-IG8 4000

Форсунки BARACUDA 6000

Фитинг 8-6 мм в сборе 50

Снятие/установка впускного коллектора 2000

Программы для настройки и диагностики ГБО (A-K)

Производитель Модель  Скачать программу
4GAS (IC) 4GAS GREEN 4GAS GREEN v3.00
4GAS II MINI 4GAS II MINI v1.0.8
4GAS II PLUS OBDCAN 4GAS II PLUS OBDCAN v2.11
4GAS II SAS
4GAS II SAS 1.0.7
4GAS II SAS 1.0.8  
4GAS II SAS 1.0.9
4GAS II SAS 1.54
4GAS II SAS 1.55 
4GAS PLUS 4GAS PLUS
4GAS Premium 4GAS Premium

4GAS

4GAS v7.0.02
4GAS v8.0.0.1
4GAS 1.13.12.0
4GAS 10.0.0.1
Autogas Italia  

 
       

Autogas Italia  

 
       

Dreamjet 5 1
DREAMJET Vers7.7
Easyjet ii 2.0.73
Easyjet software 2 0 78
Flyjet software
Lcg700
Lcg720
Pj 2.02
Powerjet plus
Powerjet v 01.14.08
Vento 06.01.04.01.ic
A-Max King King
Atiker Atiker Safefast_v1.1.0.2
NiceFast
 

AEB    


AEB
Aeb 214 obd scan tool
Aeb 424-426 obd scan tool v 5.1.3
Aeb 2001 n 6.1.0.342 ic
Aeb autronic-emmegas ecu07 1.03.68

Leonardo

Leonardo aeb175 v.3.1.0
Leonardo aeb175 v.2.3.0
Leonardo 4.1.1
Leonardo 2.2.3
AEB Leonardo
Voila
AEB 170 Voila
Alfatronic Pride Pride_06.02.01.00
Pride
King, MP32, MP48
KING 5.0.1
KING 5.0.7
KING 5.0.51
KING 6.0.0.0
KING 6.0.4.0
King 06.02
 Galileo Galileo
Alfatronic Eco, Pro
   
Alfatronic-0.75.3
Alfatronic-1.1.4
Alfatronic-1.7.3
AG   Razmus Razmus_Plus 3.09
Razmus 1.00
Razmus 1.11
Sirocco Sirocco 1.45.2.7
Sirocco 3.0.1.3 для G3
Sirocco_1.3.1

Zenit

Compact_1.27
Compact_1.34
Сompact_1.59
Compact_1.69
Compact SE 2.25
Compact_SE 2.30
Agc_system_1.6
Agc system 1.18
JZ_2005_1.10.16
JZ_2009_1.12.05
JZ_2013_1.14.05
AJ-500 Direct Injectionv 1.7.0
ZenitPRO_1.56
ZenitPRO_1.67
SGI II/Teleflex Ag sgi typ 2
BlueBox BlueBox 1.0.0.32
AgnesAgnes Agnes 2001
Agnes 23
Ac

     

STAG QBOX, 400 DPI, QNEXT, QMAX, DIESEL, TAP-03   Ac Stag 0.10
Ac Stag 0.12
Ac Stag 0.15
Ac Stag 0.16
Ac Stag 0.17
Ac Stag 0.20
Ac Stag 0.21
Ac Stag 0.24
Stagmobile для Android о программе
Stag Gas Computer для Android о программе
STAG TAP-01 / STAG TAP-02 AC TAP v1.6.27
STAG-300 premium 
STAG-300 ISA2, STAG-4 plus 
STAG-200/300 (после 11.09г)  
Ac Gas Synchro 2.1.1.4 stag-4
Remapper BT для Android о программе  
Ac Gas Synchro 6.0.0.37
Ac Gas Synchro 7.0.0.90
Ac Gas Synchro 7.3.0.0
Ac Gas Synchro 9.1.0.0
Ac Gas Synchro 9.3
Ac Gas Synchro 10.2.0.2
Ac Gas Synchro 10.4.0.2
Ac Gas Synchro 10.4.0.5
Ac Gas Synchro 11.1
Ac Gas Synchro 11.2.0.8
STAG 200 GoFast   Stag200GoFast 0.1.5
Stag200GoFast 0.5.5
STAG 200 Easy   Stag200Easy 0.4.0
Stag200Easy 0.5.5 

STAG-50, STAG-100, STAG-150, STAG-XL, STAG-L plus

AcLpgWin150.rar
AcLpgWin160.rar
AcLpgWin176.zip
AcLpgWin179.exe
AC LPG WIN 1.81

STAG-200/300 (до 11.09г) 

AcGasSynchro_1.9.1.6
AcGasSynchro_1.10.2.0
AcGasSynchro_1.12.5.0
AcGasSynchro_1.13.13.0
Ac Gas Synchro 1.14.1.0
Agis   Altis Altis v1.1
Altis v1.2
Agis Agis v1.38 ML
Agis v1.41
Agis v1.47
Agis Diesel Agis Diesel 1.04
Agis Diesel 1.07
M210 Agis m210 1.05
Agis m210 1.11
OBD CAN Agis_obd_can 2.90
Agis_obd_can 3.10
AKL
AKL AKL 6.0.3.3
AKL junior 1.0.0.7
Aldesa       Aldesa       Aldesa Setup RSI
Aldesa start obd can v 1.08
Aldesa technoseq max
Aldesa Technoseq V 1.0
Alpha     Alpha     Alpha 4 valve
Alpha 8 valve
Alpha m 4-8 valve
Altis Altis Altis v1.1
Anlero     Anlero     Anlero diagnostic obd
Nova sgis 2008 obd
Novasgis 1.39
Autronic AL-700 A- Mon 1.6
Amon_1_6_Ru
Amon_1_7
Amon
AL-800 Autronic AL-800
Mistral Mistral 0.23
Mistral 0.73
Mistral 1.5
Mistral II Mistral II 2.0.73
Bardolini Bardolini Bardolini 8.1
Bardolini 7.8
Bardolini 9.3
Baykan
Baykan
Baykan longas v 1.4.3
Baykan safir besta
Bedini Bedini Bedini eco geo 3000 explorer
Bigas

 

SGIS-N SGIS-N 4.6.7
SGIS-N 6.1.0
Sgisn v3.0.1
Sgisn v4.7.6
Sgis v3.4.2 no dongle
NOVA SGIS
NOVA SGIS
Nova gis
S-Gis S-Gis

Bigas
Bigas 5.1.8
Bigas direct injection I
Bigas pegaso 3.0
Bigas sgisn v515
EasyGas monoBigas EasyGas Mono
BluePower
BluePower Bluepower d v1.070
Bluepower s v3.02 obd
Bravo Bravo Bravo v 1.06 tr
Smart4 v 1.03 tr
BRC Fly RC FLY v3.0 
BRC ModiFLY 2.0
BRC Sequent BRC Sequent 2.16
BRC Sequent 24 BRC Sequent 24
BRC Sequent 56 BRC Sequent_56
BRC Sequent Fast BRC Sequent Fast
BRC Sequent Fastness BRC Sequent Fastness
BRC Sequent Plug & Drive BRC Sequent Plug & Drive
BRC Just BRC Just
BRC Just Heavy BRC Just Heavy
BRC Just Junior BRC Just Junior
BRC Eco Drive BRC Eco Drive
BSM Bardolini/Cargas Bardolini/CargasVer 8.1
Bardolini B4 9.2
Bardolini B4 9.3
Cangas Cangas Cangas obd v 3.5
Cangas plus v 4.4
Cangas v 2.12
Cavagna Cavagna Cavagna
Digitronic Maxi-2 / Maxi-2 TITAN
Digitronic maxi-2 0.4
Digitronic maxi-2 0.5
iQ Gaspro 0.19

DGI 3D-S Power

Digitronic DGI 11.1
Digital Gas Injection Digitronic DGI 10.3
DGI Easy Fast Digitronic DGI 10.0
Evolution Digitronic DGI 1.14
EasyFast Digitronic EasyFast 1.14
MP-32/MP-48/MP-48 OBD/2568 OBD/MP6C Digitronic AEB 06.02
Direct injection
Digitronic direct injection 03.00.03.00
Multipoint
Digitronic multipoint 6.2.1.0 ic
D.T. Gas DTGas Pro GasTech Pro 3.50.105.0
GasTech GasTech 2.22.60.0
Gastech 704-706-708
Gastech-2.21.30.0 drivers install
Gastech-2.22.70.0 drivers install
DTGas GT500S
GT600S
GT500S 1.2 2.6
DETEC Basic
Datecbasic 3.2.8.0
Dt basic 3.3.6.0
DETEC Super Datecsuper 1.3.8.0
Datecsuper 1.4.11.0
GT Gt basic softwarepack
Gt super softwarepack
Destro Destro Destro 8s v1
Destro plus v 4.0
Destro r2
Destro v2
Dymco
Dymco
Dymco 8.6.5
Dymco 6.2.1
EGAS
EGAS
Sly injection
Sly injection 9.4.4
Sly injection 9.9.20
Sly injection 9.14.0
EGS ARGO
Argo
EKO Eko
EGS M 23
M 25.10
Elpigaz Leonardo Leonardo
Leonardo old
Leonardo 2.2.7
Nicolaus Nicolaus
Nocolaus ver 2
Nicolaus_2004
Stella ElpigazN Stella 6.0.7.0
Elpigaznv4.9.0.i
Elpigaz 4.6
Elisa v.5.0.5 i
Elpigaz N 6.01.03.534
Elpigaz 2.3.3.95
Elpigaz 4.1.1.136 IC
Elpigaz 4.6.5
Elpigaz 6.0.2.0 IC
Elpigaz N 6.0.7.0 CAD
Elpigaz N 6.0.7.326 IC
Voila Voila
Voila_plus
Emer Emer Emer
EQUS EQUS EQUS v2.82
Emmegas Emmegas Ecu-07 v1.3.68
Ics-03
Ics-03 v4.9.1
Emer frank
CD-ROM IC 06.04.01.00
ECU-07 v1.03.48
Emmegas Suite V.2.4
Cd-rom_ic_06.05.06.00
Emmegas directinj 03.01.01.00
Emmegas Suite 20150727
FCS233/FCS233si 3.0.0
Emmegas DirectInj 03.00.03.03
ESGI ESGI ESGI ver. 2.06
ESGI-2-ver.4
ESGI-2-ver.3.03
ESGI-2-Black-ver.5.01
EKO V5_v3.12
Esgi ver 3.02 gr
Esgi ver 3.01
EcoTech EcoTech Eco tech 01.1.12.1
EkoGas
EkoGas
Ekogas 1.22
Ekogas v 1.0
Eureka Eureka Eureka 4.6
Eureka 4
Eureka 8
Eureka sgi
Eurogas EAS
Eurogas EAS
EAS Monitor
EAS Software
EuropeGas Avance Fit AvanceFit
OSCAR-N SAS Oscar-n_sas
 AVANCE 32, AVANCE 48, BASICO 24, SUPERIOR 48EG_Configuration_Center
 DYNAMICEG-Dynamic
OSCAR-SOscar S
Victor Victor077
Oscar N Plus ObdCan Oscarn_plus_obdcan
Oscar Mini OSCARN_MINI
Vector Vector-1.13
FBR  FBR       
Fbr sgi system v 13.02.06
Fbr sgi system d.07
Fbr aeb 6.01.03 ic
Fbr techno 1.07
Fbr aeb 6.0.7.326 ic
Fema     Fema    Fema sgi v.1.0
Fema sgi 1.01.10
Fema cd eco
Fobos
Fobos
FobosGas-0.40.0.1
FobosGas-0.50.4.1
Frontgas
Frontgas
Nx force ii
GFI  GFI
GFI
GasItaly        GasItaly         Gasitaly F3 20140206
Gi-f5 gi-f5gdi 03.00.01.09  c
Gi-f5
Gasitaly F1 8.1
Gasitaly F5 classic
Green Gas
Green Gas Aero
Green Gas Aero
Green Gas Be Green Gas Be
Green Gas by A.E.B. Green Gas by A.E.B.
Gomar   Lider   Lider
Lider novae
HEDEFGAS
HEDEFGAS
Hedef eko tork sgi v 2.05a
KING              KING              King 06.01.03.528
King 06.02.01.00
King 5.0.1-8
King 5.0.51 c-ad
King 5.0.7 c-ad
King 6.0.4.0 cad
King 6.1.0.0 cad

Газовое оборудование Lovato, BRC, Alpha, GOK, Digitroniс и другие в Екатеринбурге

«ГБО Сервис» представляет собой компанию, которая специализируется на установке газобаллонного оборудования. Нами предоставляются и другие услуги, такие как настройка, регулировка, текущее обслуживание и ремонт. В течение гарантийного срока данные процедуры производятся бесплатно.

Так как наши сотрудники являются высококвалифицированными специалистами, газовый комплекс будет иметь длительный срок службы. Однако это также зависит от выбранных устройств. По этой причине стоит ознакомиться с наиболее популярными производителями, которые хорошо себя зарекомендовали. Мы предоставляем свои услуги в Екатеринбурге.

ГБО Ловато

Компания LOVATO начала осуществлять свою деятельность в 1958 г. в Италии. За большой срок своего существования на рынке, она зарекомендовала себя как надежный поставщик.

Направлением ее деятельности является изготовления газобаллонного оборудования, которое предназначено для двигателей внутреннего сгорания.

Продукция LOVATO распространяется для широкого ассортимента двигателей. Это позволяет выполнить оборудование автомобиля для его последующей работы на экологически чистом топливе.

Ни в данном случае выступает сжатый природный и сжиженный нефтяной газ. Использовать системы этой фирмы можно не только для машин, но и для таких видов транспорта, как скутеры и катера.

Стоит отметить, что компания имеет собственную гоночную команду на спортивных катерах, которые оснащены газовыми комплексами. При этом она неоднократно становилась обладателем призов в международных соревнованиях.

Продукция LOVATO отличается превосходным сочетанием хорошего качества и оптимальной стоимости. Производитель обладает сертификатом подтверждения ISO 9001. У него имеется собственный научно-испытательный центр.

ГБО Brc

M.T.M. S.r.l. является производственной компанией, работающей в Италии. Ей принадлежит торговая марка BRC Gas Equipment , которая в 1972 году вышла на рынок газобаллонного оборудования.

Компанию можно назвать одним из мировых лидеров в области изготовления деталей и приборов, предназначенных для перевода автомобилей на применение такого газа, как метан и пропан-бутан.

Компания занимается разработкой и выпуском широкого спектра систем, удовлетворяющих все требования соответствующего рынка. В ее ассортименте присутствует продукция для карбюраторных авто, а также для транспорта категории Euro IV, которые оснащены диагностикой OBD.

Особенностью систем является последовательный впрыск. Это инновационная разработка Sequent с идеальными эксплуатационными показателями и высокотехнологичным исполнением. Она была одобрена конструкторами автомобилестроительной отрасли также благодаря простоте установки и настройки. Оборудование торговой марки BRC полностью производиться силами компании и дополнительно проверяется в лаборатории испытаний.

ГБО Alpha

Эта отечественная компания показывает отличные результаты области изготовления газобаллонных систем. Инновационные разработки позволяют выпускать высококачественные товары, что подтверждается необходимыми сертификатами соответствия. Кроме того владельцы автомобилей довольны использованием данного оборудования, отмечая, что оно не уступает известным торговым маркам.

Компания АЛЬФА изготавливает электронику четвертого поколения. Ею является электромеханическая часть от других производителей, таких как LOVATO и OMVL, с внесением существенных дополнений. Алгоритм функционирования программы можно назвать отличным подтверждением усердной работе и высокой квалификации российских программистов.

Разработанная ними программа выполняет самостоятельное обучение по управлению обеспечением данного вида. До этого момента подобная особенность была присуща лишь бензиновым установкам. Рассматривая данную компанию можно сделать вывод, что отечественное производство не уступает зарубежному в этой промышленной отрасли.

Газовое оборудование GOK

Компания GOK представляет собой ведущего производителя в Европе. Она специализируется на изготовлении оборудования, предназначенного для работы на сжиженном газе. Продукция приобретается с целью удовлетворения бытовых и промышленных потребностей в снабжении газом.

Установка представляет собой конструкцию, состоящую из двух баллонов. При необходимости их количество можно увеличить. При этом устройство будет разделено на резервную и рабочую сторону. Это означает, что газ будет поступать одновременно только из одного баллона. Клапан переключения выполняет функцию переключения подачи газа, что зависит от его наличия в рабочей области. Таким образом, доступна смена баллона в процессе эксплуатации конструкции.

Продукция GOK отличается не только функциональностью, но и хорошим качеством. За годы существования фирмы она успела завоевать внимание потребителей европейского рынка.

Газовое оборудование DIgitronic

Данная отечественная компания также хорошо зарекомендовала себя на рынке. Она специализируется на изготовлении газовых баллонов. Продукция специально разрабатывается для эффективного использования в российских условиях. Комплектующие выпускаются на территории России и Европы.

Представленная на рынке продукция делиться на две линейки. В первой оптимально сочетается качество и стоимость. Выпущена она была достаточно давно, но не утратила своей актуальности. Вторая линейка – является новинкой на отечественном рынке. Данная система отличается самонастройкой и эффективностью работы.

Рассмотрев наиболее популярных производителей ГБО, можно подобрать для себя наиболее подходящую систему. Если вы не можете определиться с выбором, обратитесь к нашим специалистам. Они грамотно проконсультируют вам в этом вопросе. Также мы произведем установку выбранного устройства.

✰ M E ... - Досудебное братство Phi Alpha Delta в Калифорнийском университете в Беркли

M E M B E R ✰ S P O T L I G H T✰

В центре внимания наших участников на этой неделе - Ава Олсон! Она учится на втором курсе по специальности «Американские исследования» со специализацией на истории организованной преступности, а также специализируется на государственной политике Creative и творческом писательстве.

• Семестры в ΦΑΔ: 2

• Почему вы присоединились к ΦΑΔ ?: «Мне очень нравились« Как избежать наказания за убийство »и те самые интересные мемы, в которых написано« студент-юрист »и есть кучка клетчатых нарядов. их в средней школе.Совместите это со страстью к переосмыслению справедливости, и я знал, что юриспруденция - это моя карьера. Я присоединился к PAD, потому что он дал мне навыки, необходимые для того, чтобы попасть туда, куда я хочу, без осуждения или гиперконкурентной среды. Его открытый характер делает его намного более доступным, чем другие общества до принятия закона, и я не заинтересован в том, чтобы быть частью сообщества, которое не ценит в первую очередь воодушевление своих членов ».

• Любимое воспоминание ΦΑΔ: «Кофейные чаты на самом деле! Я действительно прекрасно провел время, разговаривая с более старшими участниками, и это помогло PAD почувствовать себя как дома.»

• Другое участие в кампусе:« Недавно я начал создавать графику для эвристического шумоподавителя. Я также работаю наставником BUILD и помогаю развивать студенческую ассоциацию американских исследований. Если честно, большую часть времени и энергии я трачу на размышления о сцене Джагхеда Джонса «Я странный» из Ривердейла ».

• Планы аспирантуры? Карьерные устремления ?: «Я хочу получить докторскую степень в области американских исследований или поступить в юридический институт. Что касается карьеры, я все еще решаю, но я хочу участвовать в организации сообщества и защите интересов.»

• Чем вы занимались летом ?:« Я работал в рамках переписи населения и смотрел все «Убить Еву» ».

• Возникли какие-то новые увлечения в карантине ?: «Готовить, заниматься ремеслом, плакать в душе и звонить друзьям. Также заставляю людей играть со мной в DnD, чтобы я мог учиться на GM ».

• Любимое животное ?: Тихоходки, и я хочу ими быть .... просто запускайте в космос и затем вибрируйте оттуда

Альфа-исследование проектирования систем хранения низкоактивных отходов (технический отчет)

Фейзоллахи, Ф., Тегеранец, Б., Куапп, В. Дж. Альфа-исследование проектирования систем хранения низкоактивных отходов . США: Н. П., 1992. Интернет. DOI: 10,2172 / 10186100.

Фейзоллахи, Ф., Тегеран, Б. и Куапп, В. Дж. Исследование проектирования систем хранения низкоактивных отходов Alpha . Соединенные Штаты. https://doi.org/10.2172/10186100

Фейзоллахи, Ф., Тегеранец, Б., Куапп, В. Дж.Сидел . «Альфа-исследование проектирования систем хранения низкоактивных отходов». Соединенные Штаты. https://doi.org/10.2172/10186100. https://www.osti.gov/servlets/purl/10186100.

@article {osti_10186100,
title = {Альфа-исследование проектирования систем хранения низкоактивных отходов},
author = {Фейзоллахи, Ф. и тегеранец, Б. и Куапп, В. Дж.},
abstractNote = {Исследование проектирования системы хранения отходов (SWSDS), проведенное по заказу Департамента разработки технологий обращения с отходами Национальной инженерной лаборатории штата Айдахо (INEL), исследует относительные затраты жизненного цикла, связанные с тремя концепциями системы для обработки альфа-низкоактивных отходов ( альфа-НАО), хранящиеся в трансурановой зоне хранения комплекса по обращению с радиоактивными отходами в ИНЭЛ.Три концепции системы: сжигание / плавление; термическая обработка / отверждение; и сортировать, обрабатывать и переупаковывать. SWSDS определяет функциональные и эксплуатационные требования к системе и оценивает возможность реализации; эффективность; Стоимость; и требования к демонстрации, тестированию и оценке (DT&E) для каждой из трех концепций.},
doi = {10.2172 / 10186100},
url = {https://www.osti.gov/biblio/10186100}, журнал = {},
номер =,
объем =,
place = {United States},
год = {1992},
месяц = ​​{8}
}

рецепторов NMDA 2A в клетках парвальбумина опосредуют быструю реакцию кетамина, специфичную для пола, на корковую активность

  • 1.

    Берман Р., Берман Р.М., Каппиелло А., Ананд А., Орен Д.А., Хенингер Г.Р. и др. Антидепрессивные эффекты кетамина у пациентов с депрессией. Биол Психиатрия. 2000; 47: 351–4.

    CAS Статья Google Scholar

  • 2.

    Прайс РБ, Нок МК, Чарни Д.С., Мэтью С.Дж. Влияние внутривенного кетамина на явные и неявные показатели суицидальности при резистентной к лечению депрессии. Биол Психиатрия. 2009. 66: 522–6.

    CAS Статья Google Scholar

  • 3.

    Гарсия LSB, Comim CM, Valvassori SS, Réus GZ, Barbosa LM, Andreazza AC и др. Острое введение кетамина вызывает эффекты, подобные антидепрессантам в тесте принудительного плавания, и увеличивает уровни BDNF в гиппокампе крыс. Prog Neuro-Psychopharmacol Biol Psychiatry. 2008; 32: 140–4.

    CAS Статья Google Scholar

  • 4.

    Autry AE, Adachi M, Nosyreva E, Na ES, Los MF, Cheng P, et al. Блокада рецепторов NMDA в состоянии покоя вызывает быстрые поведенческие реакции на антидепрессанты.Природа. 2011; 475: 91–5.

    CAS Статья Google Scholar

  • 5.

    Jaso BA, Niciu MJ, Iadarola ND, Lally N, Richards EM, Park M, et al. Терапевтическая модуляция рецепторов глутамата при большом депрессивном расстройстве. Curr Neuropharmacol. 2017; 15: 57–70.

    Артикул Google Scholar

  • 6.

    Маллик Ф., Маккалламсмит CB. Кетамин для лечения суицидальных мыслей и снижения риска суицидального поведения.Curr Psychiatry Rep.2016; 18: 61.

    Артикул Google Scholar

  • 7.

    Feder A, Parides MK, Murrough JW, Perez AM, Morgan JE, Saxena S, et al. Эффективность внутривенного кетамина для лечения хронического посттравматического стрессового расстройства: рандомизированное клиническое исследование. JAMA Psychiatry. 2014; 71: 681–8.

    CAS Статья Google Scholar

  • 8.

    Патрици А., Пикард Н., Саймон А. Дж., Стрелок Г., Центофанте Е., Эндрюс Н. А. и др.Хроническое введение кетамина, антагониста рецепторов N-метил-D-аспартата, улучшает фенотип синдрома Ретта. Биол Психиатрия. 2015; 79: 755–64.

    Артикул Google Scholar

  • 9.

    Carrier N, Kabbaj M. Половые различия в эффектах кетамина, подобных антидепрессантам. Нейрофармакология. 2013; 70: 27–34.

    CAS Статья Google Scholar

  • 10.

    Занос П., Моаддел Р., Моррис П. Дж., Георгиу П., Фишелл Дж., Элмер Г. И. и др.Независимое от ингибирования NMDAR антидепрессивное действие метаболитов кетамина. Природа. 2016; 533: 481–6.

    CAS Статья Google Scholar

  • 11.

    Белухон П., Грейс А.А. Восстановление баланса настроения при депрессии: кетамин устраняет дефицит дофамин-зависимой синаптической пластичности. Биол Психиатрия. 2014; 76: 927–36.

    CAS Статья Google Scholar

  • 12.

    Капур С., Симан П.Антагонисты рецепторов NMDA, кетамин и PCP, оказывают прямое воздействие на рецепторы допамина D (2) и серотонин 5-HT (2), что имеет значение для моделей шизофрении. Мол Психиатрия. 2002; 7: 837–44.

    CAS Статья Google Scholar

  • 13.

    Робсон М.Дж., Эллиотт М., Семинерио М.Дж., Мацумото Р.Р. Оценка сигма (σ) рецепторов в антидепрессантных эффектах кетамина in vitro и in vivo. Eur Neuropsychopharmacol. 2012; 22: 308–17.

    CAS Статья Google Scholar

  • 14.

    Гупта А., Деви Л.А., Гомес И. Усиление передачи сигналов, опосредованной μ-опиоидными рецепторами, с помощью кетамина. J Neurochem. 2011; 119: 294–302.

    CAS Статья Google Scholar

  • 15.

    МакНалли Дж. М., Маккарли Р. У., Маккенна Дж. Т., Янагава Ю., Браун Р. Р.. Комплексное рецепторное посредничество острого применения кетамина на гамма-колебаниях in vitro в префронтальной коре головного мозга мышей: моделирование аномалий колебаний гамма-диапазона при шизофрении.Неврология. 2011; 199: 51–63.

    CAS Статья Google Scholar

  • 16.

    Homayoun H, Moghaddam B. Гипофункция рецептора NMDA оказывает противоположные эффекты на интернейроны префронтальной коры и пирамидные нейроны. J Neurosci. 2007. 27: 11496–500.

    CAS Статья Google Scholar

  • 17.

    Pinault D. Антагонисты рецептора N-метил D-аспартата кетамин и MK-801 вызывают связанные с бодрствованием аберрантные гамма-колебания в неокортексе крыс.Биол Психиатрия. 2008; 63: 730–5.

    CAS Статья Google Scholar

  • 18.

    Хаками Т., Джонс Н.С., Толмачева Е.А., Гаудиас Дж., Шомон Дж., Зальцберг М. и др. Гипофункция рецептора NMDA приводит к генерализованным и стойким аберрантным гамма-колебаниям независимо от гиперлокомотии и состояния сознания. PLoS One. 2009; 4: e6755.

    Артикул Google Scholar

  • 19.

    Kocsis B. Дифференциальная роль субъединиц NR2A и NR2B в аберрантных кортикальных гамма-колебаниях, вызванных антагонистом рецептора N-метил-D-аспартата. Биол Психиатрия. 2012; 71: 987–95.

    CAS Статья Google Scholar

  • 20.

    Салливан Е.М., Тими П., Хонг Л.Е., О’Доннелл П. Обратный перевод клинических электрофизиологических биомаркеров у грызунов с острым и хроническим антагонизмом к рецепторам NMDA. Нейропсихофармакология.2015; 40: 719–27.

    CAS Статья Google Scholar

  • 21.

    Паолетти П., Беллоне С., Чжоу К. Разнообразие субъединиц рецептора NMDA: влияние на свойства рецептора, синаптическую пластичность и болезнь. Nat Rev Neurosci. 2013; 14: 383–400.

    CAS Статья Google Scholar

  • 22.

    Кармигното Г., Вичини С. Зависимое от активности снижение ответов рецепторов NMDA во время развития зрительной коры.Наука. 1992; 258: 1007–11.

    CAS Статья Google Scholar

  • 23.

    Венцель А., Фритчи Дж. М., Молер Н., Бенке Д. Гетерогенность рецептора NMDA во время постнатального развития головного мозга крысы: дифференциальная экспрессия белков субъединиц NR2A, NR2B и NR2C. J Neurochem. 1997; 68: 469–78.

    CAS Статья Google Scholar

  • 24.

    Mierau S, Patrizi A, Hensch T, Fagiolini M.Клеточно-специфическая регуляция созревания рецептора NMDA с помощью MeCP2 в корковых цепях. Биол Психиатрия. 2016; 79: 746–54.

    CAS Статья Google Scholar

  • 25.

    Котермански С.Е., Вуд Дж. Т., Джонсон Дж. У. Связывание мемантина с поверхностным участком на рецепторах NMDA способствует частичному захвату. J Physiol. 2009; 587: 4589–604.

    CAS Статья Google Scholar

  • 26.

    Сапкота К., Мао З., Синовицкий П., Либер Д., Лю М., Икезу Т. и др. Вклад субъединицы GluN2D NMDAR в стимуляцию активности мозга и гамма-колебаний кетамином; последствия для шизофрении. J Pharmacol Exp Ther. 2016; 356: 702–11.

  • 27.

    Donner NC, Lowry CA. Половые различия в тревожности и эмоциональном поведении. Pflug Arch Eur J Physiol. 2013; 465: 601–26.

    CAS Статья Google Scholar

  • 28.

    Stein MB, Walker JR, Forde DR. Гендерные различия в предрасположенности к посттравматическому стрессовому расстройству. Behav Res Ther. 2000; 38: 619–28.

    CAS Статья Google Scholar

  • 29.

    Паркер Г., Бротчи Х. Гендерные различия при депрессии. Int Rev Psychiatry. 2010. 22: 429–36.

    Артикул Google Scholar

  • 30.

    Грей Дж.А., Ши Й., Усуи Х., Во время MJ, Сакимура К., Николл Р.А.Определенные способы подавления рецептора AMPA при развитии синапсов с помощью GluN2A и GluN2B: делеция субъединицы рецептора NMDA одной клетки in vivo. Нейрон. 2011. https://doi.org/10.1016/j.neuron.2011.08.007.

    CAS Статья Google Scholar

  • 31.

    Фаджиолини М., Катагири Х., Миямото Х., Мори Х., Грант СГН, Мишина М. и др. Отдельные особенности зрительной корковой пластичности, выявленные с помощью передачи сигналов рецептора 2А N-метил-D-аспартата. Proc Natl Acad Sci USA.2003; 100: 2854–9.

    CAS Статья Google Scholar

  • 32.

    Мейер А.Х., Катона И., Блатоу М., Розов А., Моньер Х. Мечение парвальбумин-положительных интернейронов in vivo и анализ электрического взаимодействия в идентифицированных нейронах. J Neurosci. 2002; 22: 7055–64.

    CAS Статья Google Scholar

  • 33.

    McLean AC, Valenzuela N, Fai S, Bennett SA. Проведение вагинального лаважа, окрашивания кристаллическим фиолетовым и цитологического анализа влагалища для определения стадии эстрального цикла мышей.J Vis Exp. 2012; 67: e4389.

  • 34.

    Ниелл К.М., Страйкер М.П. Высокоселективные рецептивные поля в зрительной коре головного мозга мыши. J Neurosci. 2008. 28: 7520–36.

    CAS Статья Google Scholar

  • 35.

    Muthukumaraswamy SD, Shaw AD, Jackson LE, Hall J, Moran R, Saxena N. Доказательства того, что субанестетические дозы кетамина вызывают устойчивые нарушения NMDA и AMPA-опосредованной лобно-теменной связи у людей. J Neurosci.2015; 35: 11694–706.

    CAS Статья Google Scholar

  • 36.

    Бартос М., Вида И., Йонас П. Синаптические механизмы синхронизированных гамма-колебаний в тормозных интернейронных сетях. Nat Rev Neurosci. 2007; 8: 45–56.

    CAS Статья Google Scholar

  • 37.

    Sohal VS, Zhang F, Yizhar O, Deisseroth K. Парвальбуминные нейроны и гамма-ритмы улучшают работу коркового контура.Природа. 2009; 459: 698–702.

    CAS Статья Google Scholar

  • 38.

    Велле К.Г., Контрерас Д. Сенсорные и спонтанные гамма-колебания задействуют различные корковые цепи. J Neurophysiol. 2016; 115: 1821–35.

    Артикул Google Scholar

  • 39.

    Pozzi L, Dorocic IP, Wang X, Carlén M, Meletis K. Мыши, лишенные рецепторов NMDA в парвальбуминовых нейронах, демонстрируют нормальное поведение, связанное с депрессией, и реакцию на антидепрессивное действие антагонистов NMDAR.PLoS One. 2014; 9: e91486.

    Артикул Google Scholar

  • 40.

    Ван Х-Х, Гао В-Дж. Клеточно-специфическое развитие рецепторов NMDA в интернейронах префронтальной коры головного мозга крыс. Нейропсихофармакология. 2009; 34: 2028–40.

    CAS Статья Google Scholar

  • 41.

    Эль-Бакри Н.К., Ислам А., Чжу С., Эльхассан А. Эффекты лечения эстрогеном и прогестероном на NMDA-рецепторы гиппокампа крыс: взаимосвязь с работой водного лабиринта Морриса.J Cell Mol Med. 2004; 8: 537–44.

    CAS Статья Google Scholar

  • 42.

    Gazzaley AH, Weiland NG, McEwen BS, Morrison JH. Дифференциальная регуляция мРНК и белка NMDAR1 эстрадиолом в гиппокампе крыс. J Neurosci. 1996. 16: 6830–8.

    CAS Статья Google Scholar

  • 43.

    Romeo RD, McCarthy JB, Wang A, Milner TA, McEwen BS. Половые различия в индуцированном эстрадиолом гиппокампе связывания N-метил-D-аспарагиновой кислоты и ультраструктурной локализации рецептора эстрогена-альфа.Нейроэндокринология. 2005; 81: 391–9.

    CAS Статья Google Scholar

  • 44.

    Джелкс К.Б., Уайли Р., Флойд С.Л., Макаллистер А.К., Уайз П. Эстрадиол нацелен на синаптические белки, чтобы вызвать образование глутаматергических синапсов в культивируемых нейронах гиппокампа: критическая роль рецептора эстрогена-альфа. J Neurosci. 2007. 27: 6903–13.

    CAS Статья Google Scholar

  • 45.

    Woolley CS, Weiland NG, McEwen BS, Schwartzkroin PA. Эстрадиол увеличивает чувствительность пирамидных клеток СА1 гиппокампа к синаптическому входу, опосредованному рецептором NMDA: корреляция с плотностью дендритных шипов. J Neurosci. 1997; 17: 1848–59.

    CAS Статья Google Scholar

  • 46.

    Wong M, Moss RL. Долгосрочные и краткосрочные электрофизиологические эффекты эстрогена на синаптические свойства нейронов CA1 гиппокампа. J Neurosci.1992; 12: 3217–25.

    CAS Статья Google Scholar

  • 47.

    Домингес Р., Лю Р., Бодри М. 17-бета-эстрадиол-опосредованная активация регулируемой внеклеточным сигналом киназы, фосфатидилинозитол-3-киназы / протеинкиназы B-Akt и фосфорилирования рецептора N-метил-D-аспартата в корковых синаптоневросомах. J Neurochem. 2007; 101: 232–40.

    CAS Статья Google Scholar

  • 48.

    Джавитт округ Колумбия. Рецепторы глутамата как терапевтические мишени. Мол Психиатрия. 2004; 9: 979.

    Артикул Google Scholar

  • 49.

    Олни Дж. У., Лабрюйер Дж. Прайс МТ. Патологические изменения, вызванные фенциклидином и родственными ему лекарственными средствами в нейронах головного мозга. Наука. 1989; 244: 1360–2.

    CAS Статья Google Scholar

  • 50.

    Си Д., Чжан В., Ван Х-Х, Стрэдтман Г.Г., III, Гао В-Дж, Гао В-Дж.Дизоцилпин (MK-801) вызывает отчетливые изменения субъединиц рецептора N-метил-D-аспарагиновой кислоты в парвальбуминсодержащих интернейронах в префронтальной коре головного мозга молодых взрослых крыс. Int J Neuropsychopharmacol. 2009; 12: 1395–408.

    CAS Статья Google Scholar

  • 51.

    Franceschelli A, Sens J, Herchick S, Thelen C, Pitychoutis PM. Половые различия в быстром и длительном действии кетамина, аналогичном антидепрессанту, у не подвергшихся стрессу и «депрессивных» мышей, подвергшихся хроническому легкому стрессу.Неврология. 2015; 290: 49–60.

    CAS Статья Google Scholar

  • 52.

    Эбине Т., Торими Х., Симидзу Т., Унекава М., Такидзава Т., Каяма Ю. и др. Изменения порога концентрации калия, вызывающие депрессию распространения коркового вещества во время естественного эстрального цикла у мышей. Neurosci Res. 2016; 112: 57–62.

    CAS Статья Google Scholar

  • 53.

    Грент-‘т-Джонг Т., Риволта Д., Гросс Дж., Гаджвани Р., Лори С.М., Шваннауэр М. и др. Острый кетамин нарушает регуляцию связанных с заданием колебаний гамма-диапазона в таламо-корковых цепях при шизофрении. Мозг. 2018. https://doi.org/10.1093/brain/awy175.

    Артикул Google Scholar

  • 54.

    Ян И, Цуй И, Санг К., Донг И, Ни З, Ма С. и др. Кетамин блокирует разрыв боковой габенулы, быстро снимая депрессию. Природа. 2018; 554: 317–22.

    CAS Статья Google Scholar

  • 55.

    Covington HE, Lobo MK, Maze I, Vialou V, Hyman JM, Zaman S, et al. Антидепрессивный эффект оптогенетической стимуляции медиальной префронтальной коры. J Neurosci. 2010. 30: 16082–90.

    CAS Статья Google Scholar

  • 56.

    Grunze HCR, Rainnie DG, Hasselmo ME, Barkai E, Hearn EF, Mccarley RW, et al. NMDA-зависимая модуляция ингибирования локальной цепи CA1.J Neurosci. 1996; 76: 2034–43.

    Артикул Google Scholar

  • 57.

    Миддлтон С., Джаликс Дж., Кисперски Т., Лебо ФЕН, Роопун А.К., Копелл Нью-Джерси и др. Зависимое от рецептора NMDA переключение между различными микросхемами, генерирующими гамма-ритм, в энторинальной коре. Proc Natl Acad Sci USA. 2008; 105: 18572–7.

    CAS Статья Google Scholar

  • 58.

    Li Q, Clark S, Lewis DV, Wilson WA.Антагонисты рецепторов NMDA подавляют активность задней поясной извилины и ретросплениальной коры головного мозга крысы: потенциальный механизм нейротоксичности. J Neurosci. 2002; 22: 3070–80.

    CAS Статья Google Scholar

  • 59.

    Olney JW, Newcomer JW, Farber NB. Модель гипофункции рецептора NMDA при шизофрении. J Psychiatr Res. 1999; 33: 523–33.

    CAS Статья Google Scholar

  • 60.

    Widman AJ, McMahon LL. Подавление пирамидных клеток CA1 низкими дозами кетамина и других антагонистов с быстрой антидепрессивной эффективностью. Proc Natl Acad Sci USA. 2018. https://doi.org/10.1073/pnas.1718883115.

    CAS Статья Google Scholar

  • 61.

    Такахата Р., Могхаддам Б. Активация нейротрансмиссии глутамата в префронтальной коре головного мозга поддерживает моторные и дофаминергические эффекты фенциклидина. Нейропсихофармакология.2003; 28: 1117–24.

    CAS Статья Google Scholar

  • 62.

    Hong E, Summerfelt A, Buchanan RW, O’Donnell P, Thaker GK, Weiler MA, et al. Гамма- и дельта-нервные колебания и связь с клиническими симптомами при субанестетическом кетамине. Нейропсихофармакология. 2009; 35: 632–40.

    Артикул Google Scholar

  • 63.

    Abdallah CG, de Feyter HM, Averill LA, Jiang L, Averill CL, Chowdhury GMI, et al.Влияние кетамина на префронтальную нейротрансмиссию глутамата у здоровых и депрессивных субъектов. Нейропсихофармакология. 2018. https://doi.org/10.1038/s41386-018-0136-3.

    CAS Статья Google Scholar

  • 64.

    Carceller H, Perez-Rando M, Castren E, Nacher J, Guirado R. Влияние антидепрессанта флуоксетина на соматостатиновые интернейроны в базолатеральной миндалине. Неврология. 2018; 386: 205–13.

    CAS Статья Google Scholar

  • 65.

    Fuchs T, Jefferson SJ, Hooper A, Yee PH, Maguire J, Luscher B. Ингибирование соматостатин-положительных ГАМКергических интернейронов приводит к анксиолитическому и антидепрессантоподобному состоянию мозга. Мол Психиатрия. 2017. https://doi.org/10.1038/mp.2016.188.

    Артикул Google Scholar

  • 66.

    Kinney JW, Davis CN, Tabarean I, Conti B, Bartfai T., Behrens MM. Специфическая роль NR2A-содержащих рецепторов NMDA в поддержании иммунореактивности парвальбумина и GAD67 в культивируемых интернейронах.J Neurosci. 2006; 26: 1604–15.

    CAS Статья Google Scholar

  • 67.

    Си Д., Киллер Б., Чжан В., Хоул Дж. Д., Гао В. Дж.. Экспрессия субъединицы рецептора NMDA в ГАМКергических интернейронах префронтальной коры: применение техники лазерной микродиссекции. J Neurosci Methods. 2009. 176: 172–81.

    CAS Статья Google Scholar

  • 68.

    Миллер О.Н., Ян Л., Ван СС, Харгродер Е.А., Чжан И., Дельпир Е. и др.GluN2B-содержащие рецепторы NMDA регулируют депрессивное поведение и имеют решающее значение для быстрого антидепрессивного действия кетамина. eLife. 2014. https://doi.org/10.7554/eLife.03581.

  • 69.

    Yazaki-Sugiyama Y, Kang S, Câteau H, Fukai T, Hensch TK. Двунаправленная пластичность в схемах с быстрым выбросом ГАМК на основе визуального опыта. Природа. 2009; 462: 218–21.

    CAS Статья Google Scholar

  • 70.

    Cabungcal JH, Steullet P, Morishita H, Kraftsik R, Cuenod M, Hensch TK и др.Перинейрональные сети защищают интернейроны с быстрыми импульсами от окислительного стресса. Proc Natl Acad Sci USA. 2013; 110: 9130–5.

    CAS Статья Google Scholar

  • 71.

    Kohr G, Eckardt S, Luddens H, Monyer H, Seeburg PH. Каналы рецепторов NMDA: субъединично-специфическое усиление восстановителями. Нейрон. 1994; 12: 1031–40.

    CAS Статья Google Scholar

  • 72.

    Morissette M, Le Saux M, D’Astous M, Jourdain S, Al Sweidi S, Morin N и др. Вклад альфа- и бета-рецепторов эстрогена в действие эстрадиола на мозг. J Стероид Biochem Mol Biol. 2008. 108: 327–38.

    CAS Статья Google Scholar

  • 73.

    Чаритиди К., Мельцер И., Канлон Б. Лечение эстрадиолом и гормональные колебания во время эстрального цикла модулируют экспрессию рецепторов эстрогена в слуховой системе и предымпульсное подавление реакции акустического вздрагивания.Эндокринология. 2012; 153: 4412–21.

    CAS Статья Google Scholar

  • 74.

    Behr GA, Motta LL, da, Oliveira MR, de, Oliveira MWS, Hoff MLM, Silvestrin RB, et al. Снижение тревожного поведения и двигательной / исследовательской активности, а также модуляция окислительно-восстановительного профиля гипоталамуса, гиппокампа и лобной коры у сексуально восприимчивых самок крыс после кратковременного воздействия химических сигналов самцов. Behav Brain Res. 2009; 199: 263–70.

    CAS Статья Google Scholar

  • 75.

    Селия Морейра Борелла V, Симан М.В., Карнейро Кордейру Р., Виейра душ Сантуш Дж., Ромариу Матуш де Соуза М., Нуньес де Соуза Фернандес Е. и др. Пол и эстральный цикл влияют на поведенческие и нейрохимические изменения у взрослых крыс, которым неонатально вводили кетамин. Dev Neurobiol. 2016; 76: 519–32.

    Артикул Google Scholar

  • 76.

    Rybakowski JK, Permoda-Osip A, Bartkowska-Sniatkowska A. Увеличение кетамина быстро улучшает показатели депрессии у стационарных пациентов с устойчивой к лечению биполярной депрессией. Int J Psychiatry Clin Pract. 2017; 21: 99–103.

    CAS Статья Google Scholar

  • (PDF) Быстрый алгоритм на основе Ланжевена для MCMC в больших размерностях

    [19] Г. О. Робертс, А. Гельман и В. Р. Гилкс. Слабая сходимость и оптимальное масштабирование

    алгоритмов случайного блуждания

    Метрополиса.Аня. Прил. Probab., 7 (1): 110–120, 1997.

    [20] Г. О. Робертс, Дж. С. Розенталь. Оптимальное масштабирование дискретных приближений к

    ланжевеновской диффузии. J. R. Stat. Soc. Сер. B Стат. Methodol., 60 (1): 255–268, 1998.

    [21] G.O. Roberts и O. Stramer. Диффузии Ланжевена и алгоритмы Метрополиса-Гастингса.

    Методол. Comput. Прил. Probab., 4 (4): 337–357 (2003), 2002. Международный семинар

    по прикладной теории вероятностей (Каракас, 2002).

    [22] Г.О. Робертс и Р. Л. Твиди. Экспоненциальная сходимость распределений Ланжевена

    и их дискретные приближения. Бернулли, 2 (4): 341–363, 1996.

    [23] Г. О. Робертс и Р. Л. Твиди. Геометрическая сходимость и центральные предельные теоремы для

    многомерных алгоритмов Гастингса и Метрополиса. Biometrika, 83 (1): 95–110, 1996.

    [24] Д. Талай и Л. Тубаро. Расширение глобальной ошибки для численных схем решения

    стохастических дифференциальных уравнений.Стохастический анал. Appl., 8 (4): 483–509 (1991), 1990.

    [25] I. Wolfram Research. Mathematica. 2014.

    Доказательство теорем 3.1 и 3.2

    Здесь мы приводим доказательства теорем 3.1 и 3.2 для анализа свойств оптимального масштабирования

    fMALA. Мы используем инструменты, аналогичные [19] и [20]. Рассмотрим генератор

    процесса скачка Γd, fM, определенный для ψd∈C2

    c (Rd) и x∈Rdby

    AfM

    dψd (x) = d1 / 5Eh (ψd (y) −ψd ( x)) αfM

    d (x, y) i,

    , где y следует распределению, определенному qfM

    d (x, ·).Также рассмотрим генератор процесса

    {Gt, t ≥0}, решение (16), определенное для ψ∈C2

    c (R), и x∈Rdby

    AfMψ (x) = (h ( ℓ) / 2) (ψ ′ (x1) f (x1) + ψ ′ ′ (x1)).

    Мы проверяем, что условия [5, следствие 8.7, гл. 4] выполняются, что из

    влечет теорему 3.2. Эти предположения состоят в том, чтобы показать, что существует последовательность из множества

    {Fd⊂Rd, d ∈N ∗} такая, что для всех T≥0:

    lim

    d → + ∞

    PhΓd, fM

    s∈Fd , ∀s∈ [0, T] i = 1

    lim

    d → + ∞sup

    x∈FdAfM

    dψ (x) −AfMψ (x)  = 0,

    для всех функций ψ в ядре AfM, которое сильно разделяет точки.Поскольку AfM является оператором

    на множестве функций, зависящим только от первого компонента, мы ограничиваем наше исследование этим классом функций

    , которые принадлежат C∞

    c (R), поскольку согласно [5, теорема 2.1 , Глава 8], этот набор из

    функций является ядром для AfM, которое строго разделяет точки. Следующая лемма является правильным результатом

    , введенным в разделе 2.2. В дальнейшем пусть {ξi, i ∈N ∗} будет последовательностью

    i.i.d. стандартные одномерные гауссовские случайные величины, а X - случайная величина

    , распределенная согласно π1.Кроме того, для всех x∈Rd обозначим через yfM предложение fMALA,

    , определенное (8), (10a) и (10b), начавшееся в x∈Rd, с параметром hd и связанным с

    d-мерным гауссовским случайная величина {ξi, i = 1, ..., d}.

    21

    Открытие бактериальных взаимодействий фимбрий и гликанов с использованием рекомбинантной цельноклеточной экспрессии Escherichia coli

    РЕФЕРАТ

    Фимбрии шаперон-ушера (CU) являются наиболее распространенными грамотрицательными бактериальными фимбриями с 38 различными типами CU. Только кишечная палочка.Некоторые фимбрии CU E. coli были хорошо охарактеризованы и связываются со специфическими гликановыми мишенями, обеспечивая тканевый тропизм. Например, фимбрии типа 1 связываются с α-d-маннозилированными гликопротеинами, такими как уроплакины, в мочевом пузыре через свой расположенный на кончике адгезин FimH, что приводит к колонизации и инвазии эпителия мочевого пузыря. Несмотря на это, аффинность связывания рецептора многих других типов фимбрий E. coli CU остается плохо изученной. Здесь мы использовали рекомбинантный штамм E. coli, экспрессирующий различные фимбрии CU, в сочетании с анализом гликанового массива, содержащего> 300 гликанов, для анализа специфичности рецептора CU фимбрий.Первоначально мы подтвердили подход, продемонстрировав очищенный лектин-связывающий домен FimH и рекомбинантную E.coli, экспрессирующую фимбрии типа 1, связанные с аналогичным набором гликанов. Затем этот метод был использован для картирования аффинности связывания гликанов шести дополнительных фимбрий CU, а именно фимбрий P, F1C, Yqi, Mat / Ecp, K88 и K99. Аффинность связывания определяли с использованием плазмонного резонанса на поверхности цельной бактериальной клетки. Эта работа описывает новую информацию о фимбриальной специфичности и быстрой и масштабируемой системе для определения новых адгезин-гликановых взаимодействий, которые лежат в основе бактериальной колонизации и болезни.

    ВАЖНОСТЬ Понимание тропизма патогенов для хозяина и ткани требует полного понимания рецепторов хозяина, на которые нацелены фимбриальные адгезины. Кроме того, блокирование адгезии является многообещающей стратегией противодействия увеличению устойчивости к антибиотикам и становится возможным благодаря идентификации рецепторов хозяина. Здесь мы используем определенную гетерологичную систему экспрессии E. coli для идентификации гликановых рецепторов для шести шаперонных фимбрий и идентификации новых рецепторов, которые соответствуют их известной функции.Эту же систему использовали для измерения кинетики связывания с идентифицированным гликаном, при этом бактериальные клетки были иммобилизованы на биосенсорном чипе, а взаимодействия с гликанами были количественно определены с помощью поверхностного плазмонного резонанса. Этот новый двухуровневый анализ, при котором скрининг репертуара связывания гликанов и иерархия аффинности идентифицированных лигандов определяется непосредственно на основе изначально экспрессируемой фимбриальной структуры на поверхности бактериальной клетки, превосходит как по пропускной способности, так и по биологической значимости.

    ВВЕДЕНИЕ

    Фимбрии (также известные как пили) представляют собой белковые структуры, которые выходят на поверхность многих бактерий. Эти органеллы опосредуют различные функции, связанные с колонизацией поверхностей и вирулентностью, включая адгезию и образование биопленок. Большинство бактериальных фимбрий состоят из основного повторяющегося белка, который составляет основную часть органеллы, а также из адгезина, расположенного на кончике. Адгезин обычно распознает специфические рецепторы-мишени по принципу "замок-и-ключ", тем самым определяя тропизм ткани.

    У грамположительных и грамотрицательных бактерий описано много различных типов фимбрий (1, 2). У грамотрицательных бактерий наиболее многочисленны фимбрии, собранные системой шаперон-ушер (CU), при этом фимбрии CU Escherichia coli наиболее охарактеризованы (3). Прототипом фимбрий CU являются фимбрии типа 1 и P из уропатогенной E. coli (UPEC), и их регуляция, биогенез, структура и функция были тщательно изучены (3-7). Фимбрии типа 1 простираются на ∼1.0 мкм от поверхности клетки и состоят из основной субъединицы (FimA), а также фибриллы кончика, состоящей из нескольких второстепенных компонентов, включая адгезин FimH (8-10). FimH связывается с α-d-маннозилированными гликопротеинами, такими как уроплакины, которых много в мочевом пузыре (11), тем самым облегчая колонизацию UPEC и инвазию эпителия мочевого пузыря (12, 13). P-фимбрии имеют аналогичную общую структуру, состоящую из основного структурного белка (PapA), который составляет основную часть органеллы, которая связана с концевой фибриллой, состоящей из основной (PapE) и минорной (PapF, PapK и PapG) субъединиц ( 14).Адгезин PapG расположен на дистальном конце фибриллы и связывается с Galα (1-4) Gal-содержащими гликолипидами (15). В отношении аффинности связывания описаны три класса адгезина PapG. Адгезин класса I связывается с глоботриаозилцерамидом (GbO 3 ), адгезин класса II связывается с глоботетраозилцерамидом (GbO 4 ), а адгезин класса III связывается с гликолипидом Форссмана с помощью концевого GalNAc (GbO23 5 ). (15, 16). Аллель PapG класса II является наиболее распространенным типом адгезина, обнаруживаемым в штаммах UPEC, вызывающих пиелонефрит, и необходим для колонизации верхних мочевыводящих путей в модели инфекции приматов, отличных от человека (17).

    Анализ данных полногеномных последовательностей выявил необычайное разнообразие фимбрий CU на генетическом уровне (18). Действительно, 38 различных фимбриальных типов CU были идентифицированы только в E. coli на основании филогении консервативного белка-инициатора и положения локуса генома (19). Это изменение также отражается в рецепторной специфичности адгезина кончика (или лектина) к конкретным гликанам (20) и определяет целевые свойства адгезии, связанные с различными патотипами E. coli.Например, фимбрии CU, включая P, F1C и S, часто связаны с UPEC и E. coli, ассоциированными с менингитом (NMEC) (17, 21, 22), фимбрии агрегированного прилипания (AAF) связаны с энтероагрегативными E. coli. (EAEC) (23), длинные полярные фимбрии (LPF) связаны с энтеропатогенными E. coli (EPEC) и энтерогеморрагическими E. coli (EHEC) (24), CS1-CFA / I связаны с энтеротоксигенными E. coli человека ( ETEC) (25), а фимбрии K88 (F4) и K99 (F5) связаны с ETEC свиней, крупного рогатого скота и овец (26, 27).Большинство штаммов E. coli также содержат различные комбинации фимбриальных генов CU (19, 28), и эти фимбрии могут работать совместно, определяя тропизм к конкретным участкам инфекции. Недавняя работа показала, что экспрессия фимбрий Ucl (также известных как F17-подобные фимбрии) (29) способствует колонизации UPEC в кишечнике, обеспечивая формирование резервуара для последующей инфекции мочевыводящих путей из-за экспрессии типа 1 фимбрии (30). Более того, понимание этих взаимодействий на молекулярном уровне представляет собой захватывающий подход к разработке новых антиадгезионных молекул в качестве альтернативных методов лечения для нарушения колонизации патогенами с множественной лекарственной устойчивостью (30–34).

    Несмотря на наши знания о разнообразии фимбрий CU и вкладе отдельных фимбрий в патогенез, многие фимбрии CU еще предстоит должным образом охарактеризовать. Кроме того, отсутствует полное понимание специфичности их рецепторов. В этом исследовании мы разработали новый подход к рассечению связывания фимбрии CU с использованием гликанового массива. Во-первых, мы показали, что профиль связывания гликанов очищенного лектин-связывающего домена адгезина FimH (FimH LD ) и рекомбинантного штамма E. coli, экспрессирующего фимбрии типа 1, схожи, демонстрируя, что быстрый скрининг бактерий, экспрессирующих один тип CU фимбрии можно использовать для анализа рецепторной специфичности.Затем серия плазмид, содержащих гены, кодирующие дополнительные 12 фимбрий CU, включая P (представляющий три аллельных варианта PapG), F1C, Afa, F9, Yqi, Mat (также известный как Ecp), тип 3, K88 (типы AB и AC. ) и K99 трансформировали в штамм MS428, отрицательный по K-12 fim E. coli, и эти рекомбинантные штаммы подвергали скринингу на связывание со специфическими гликанами. В целом, мы смогли определить набор рецептор-связывающих фенотипов для каждой фимбрии CU, многие из которых соответствовали их специфической ассоциации с патотипами.

    РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

    Очищенный лектин-связывающий домен FimH и рекомбинантные клетки, экспрессирующие фимбрии 1-го типа, взаимодействуют с аналогичными гликанами на основе скрининга гликанового массива. экранировать гликановые мишени на массивах. Однако такие подходы не поддаются высокопроизводительному исследованию из-за потребности в очищенном белке. Кроме того, домены рекомбинантных очищенных белков могут не соответствовать нативно экспрессируемым фимбриальным белкам на поверхности бактериальных клеток.Поэтому мы начали с изучения репертуара связывания гликанов фимбрий типа 1 в качестве модели, хорошо охарактеризованной системы с использованием двух параллельных подходов: (i) очищенный функциональный белок FimH LD , слитый на С-конце с 6-кратной гистидиновой меткой (35 ) и (ii) рекомбинантный штамм с делецией E. coli K-12 fim (MS428) (36), трансформированный плазмидой, содержащей кластер генов fimAICDFGH (pPKL4) (37). В общем, очищенный FimH LD и рекомбинантный штамм MS428, экспрессирующий фимбрии типа 1 (pPKL4), связаны с очень похожей группой родственных и перекрывающихся гликанов на массиве (рис.1; см. также набор данных S1 в дополнительном материале). Это охватывало широкий спектр маннозосодержащих гликанов, включая моносахарид α-маннозы, α1-2-, 3-, 4- и 6-связанные маннобиозы, а также разветвленные структуры маннозы, такие как Man5 (рис. ). Несколько гликановых структур, не оканчивающихся маннозой, также были связаны либо FimH LD , либо MS428 (pPKL4), что позволяет предположить, что существуют незначительные конформационные различия, которые могут объяснить небольшую разницу в связывании между очищенным белком FimH LD и нативно экспрессируемым интегрированным FimH. на кончике структуры фимбрии 1-го типа.Действительно, было показано, что FimH принимает конформации связывания как с низким, так и с высоким сродством, которые могут объяснить этот феномен (38). MS428, несущий пустой вектор (набор данных S1), не наблюдал связывания с массивом гликанов, демонстрируя, что взаимодействия гликанов были зависимыми от фимбрий 1 типа. В целом, связывание FimH , LD и MS428 (pPKL4) с концевыми структурами маннозы полностью согласуется с опубликованным профилем связывания адгезина FimH (39), поддерживая подход, использующий рекомбинантные цельные клетки для определения профиля связывания гликанов определенного типа. фимбрий.

    Рис. 1

    Анализ гликановой матрицы ряда фимбриальных белков из E. coli. На этом рисунке представлено графическое представление паттерна связывания фимбриальных белков с 375 гликанами, присутствующими на гликановом микрочипе Института гликомики, для выявления сходства и различий в паттернах связывания между этими белками. Полные данные, показывающие идентичность каждого связанного гликана, показаны в наборе данных S1 и подробно обсуждаются в тексте. Красный означает привязку над фоном; белый означает отсутствие привязки.Моно, моносахариды; Gal, терминальная галактоза; GalNAc, концевой N-ацетилгалактозамин; Fuc, фукозосодержащие гликаны; Сиа, сиалированные гликаны; Человек, маннозосодержащие гликаны; GlcNAc: концевой N -ацетилглюкозамин; Glc, повторяющаяся глюкоза; LMW GAG, низкомолекулярные гликозаминогликаны; HMW GAG, высокомолекулярные ГАГ.

    Набор данных S1

    Гликан-матричный анализ ряда фимбриальных белков из E. coli. Этот набор данных предоставляет информацию о связывании гликанов фимбриальных белков с 375 гликанами, присутствующими на гликановом микрочипе Института гликомики, представленном на рис.1. Красный означает привязку над фоном; белый означает отсутствие привязки. Моно, моносахариды; Gal, терминальная галактоза; GalNAc, концевой N-ацетилгалактозамин; Fuc, фукозосодержащие гликаны; Сиа, сиалированные гликаны; Человек, маннозосодержащие гликаны; GlcNAc, концевой N-ацетилглюкозамин; Glc, повторяющаяся глюкоза; LMW GAG, низкомолекулярные гликозаминогликаны; HMW GAG, высокомолекулярные ГАГ. Скачать Data Set S1, PDF-файл, MB. Авторские права © 2021 Day et al.

    Этот контент распространяется на условиях Creative Commons Attribution 4.0 Международная лицензия.

    SPR можно использовать для точного измерения межклеточных взаимодействий с гликанами. Чтобы расширить наш сравнительный анализ связывания FimH LD и MS428 (pPKL4) с гликанами, мы использовали поверхностный плазмонный резонанс (SPR) для количественного определения их аффинности связывания как Man5, так и Man5GlcNAc (рис. 2). В этих экспериментах FimH LD связывался с маннозилированными гликанами с высоким сродством (таблица 1), и значения константы диссоциации ( K D ) соответствовали ранее опубликованным данным по аффинности для FimH и этих двух структур гликанов (110 до 127 нМ для Man5 и от 12 до 20 нМ для Man5NAc) (39).Затем мы адаптировали ранее описанный метод, который использовал SPR для измерения связывания токсина с рецептором клетки млекопитающего (40), чтобы количественно оценить взаимодействие между клетками MS428 (pPKL4) и обоими гликанами (таблица 1). Эти данные соответствовали данным по аффинности, полученным с использованием FimH LD , что дополнительно подтверждает использование рекомбинантных цельных клеток, экспрессирующих определенный тип фимбрии, для точного количественного определения взаимодействий отдельных гликанов.

    Рис. 2

    Рабочий процесс сравнения очищенного FimH LD и E.coli. Слева направо, анализ матрицы гликанов сравнивает очищенный белок, обнаруженный с помощью флуоресцентных антител (красный), с бактериями, меченными флуоресцентным красителем (красный). Это обеспечивает флуоресцентные сигналы на матрице, которые могут быть обнаружены и представлены в виде связывания да / нет через 400 гликанов. Анализ поверхностного плазмонного резонанса принимает положительное связывание и позволяет определить аффинность ( K D ) с использованием либо очищенного белка (чип CM5, слой декстрана высокой плотности), либо целых бактерий (чип C1, без слоя декстрана). , переплет очень близко к поверхности золота).Для каждого анализа требуется пустая проточная кювета (FC1) с декстрановым слоем, блокированным этаноламином, используемым для белка, и иммобилизованным MS428 ( fim отрицательным) для штамма, экспрессирующего фимбрии 1 типа.

    ТАБЛИЦА 1

    Анализ поверхностного плазмона фимбриальных белков

    Анализ связывания гликанов фимбрий, связанных с колонизацией верхних мочевыводящих путей. P-фимбрии прочно связаны со штаммами E. coli, вызывающими пиелонефрит (17), благодаря их способности связываться с Эпитоп рецептора α-d-галактопиранозил- (1-4) –β-d-галактопиранозида в глобосерии гликолипидов, обнаруженных в почках человека и на эритроцитах (15, 41).P fimbriae распознает свои рецепторы через расположенный на кончике адгезин PapG, который существует в виде трех различных аллелей (PapGI, PapGII и PapGIII), которые связываются с различным сродством с эпитопами Galα [1-4] Galβ; PapGI, PapGII и PapGIII преимущественно связываются с ассоциированными с мембранами GbO3, GbO4 и GbO5 соответственно (15), в то время как три варианта демонстрируют сходную специфичность связывания, когда эти гликосфинголипиды прикреплены к искусственной поверхности (41). Здесь MS428 был использован в качестве штамма-хозяина и трансформирован плазмидами, несущими гены P-фимбрии, содержащие аллель papGI (pRHU845) или papGII (pPIL110-35).Анализ массива гликанов PapGI и PapGII продемонстрировал связывание с терминальной галактозой, включая структуры α1-3Gal, α1-4Gal и β1-3Gal (рис.1 и набор данных S1), хотя и не так много, как описано ранее (15, 17, 41). ). Основываясь на опубликованных исследованиях (15, 17, 41), мы могли ожидать, что до 50 структур на массиве покажут связывание, а не менее 10, которые наблюдались. Недавно было продемонстрировано, что массивы гликанов являются несовершенным инструментом для анализа связывания гликанов белками из-за важности презентации гликанов (42).Grant et al. продемонстрировали, что различные химические присоединения к массиву изменяют распознавание представленного гликана (42). Важно отметить, что в предыдущих исследованиях PapG использовались гликаны, связанные с церамидами, причем многие из гликанов в используемом здесь массиве имитировали представление гликопротеина / расширенного гликана, а не гликоконъюгаты, связанные с липидом. Фактически, Стромберг и др. Ранее отмечалось, что представление одних и тех же гликоконъюгатов в различных мембранных средах может изменять распознавание фимбрий PapG в сахаридных структурах (41).Мы также попытались охарактеризовать связывающие свойства адгезина PapGIII путем трансформации MS428 плазмидой pJFK102, содержащей papGIII ; однако рекомбинантный штамм проявлял неспецифическое связывание с блокированной этаноламином стеклянной поверхностью матрицы, что препятствовало точному выяснению специфических взаимодействий гликанов.

    Фимбрии F1C экспрессируются от 14 до 30% внекишечных штаммов E. coli (ExPEC), вызывающих инфекцию мочевыводящих путей (ИМП) (43, 44), и опосредуют связывание через расположенный на кончике адгезин FocH с рецепторами галактозилцерамидов на эпителиальных клетках. почки, мочеточники и мочевой пузырь, а также рецепторы глоботриаозилцерамида в почках (21, 45).MS428 трансформировали плазмидой pPKL143 (кодирующей кластер фимбрий F1C), и связывание исследовали с использованием гликанового массива. Наблюдалось связывание с девятью структурами на массиве, шестью концевыми структурами α / βGal / GalNAc (идентификаторы гликанов [IDs] 2C, 85, 262, 382 и 504; набор данных S1), двумя α2-6 сиалилированными структурами [гликан ID 10O , Neu5Acα2-6Galβ1-4GlcNAcβ1-3Galβ1-4Glc и гликан ID 627, Neu5Acα2-6Galβ1-4GlcNAcβ1-2Man) 2 -β1-3,6-Manβ1-4GNβ1-4GNβ-sp4], и два фрагмента гликана гиалуронан (гликан ID 13G), а другой - гепарин (гликан ID 12L).Хотя набор взаимодействующих гликанов для F1C фимбрий не полностью перекрывает связывание ганглиозидов и лактоцерамидов, ранее идентифицированное в литературе (21, 45), вероятно, из-за тех же проблем презентации, которые наблюдаются для фимбрий PapG, связывания с несколькими ранее идентифицированными структурами, включая высокоаффинная структура asialoGM1. Анализ SPR показал, что клетки MS428 (pPKL143) прочно связываются с asialoGM1 с 109 нМ K D (таблица 1).

    Анализ связывания гликанов других E.coli CU фимбрии. Еще четыре CU фимбрии были исследованы для определения их специфических взаимодействующих гликановых рецепторов. Связанные с менингитом и регулируемые температурой (Mat) фимбрии были впервые идентифицированы в клональной группе O18: K1: H7 (ST95) NMEC (46). Последующая работа показала, что эти фимбрии также продуцируются другими типами E. coli, включая диареагенные штаммы, что привело к их переименованию в E. coli common pilus, или ECP (47). Здесь гены Mat / ECP амплифицировали с помощью ПЦР из эталонного штамма UPEC CFT073 (ST73), клонировали в плазмиду pUC19 и трансформировали в MS428 для получения штамма MS428 (pMAT).Целые клетки MS428 (pMat), экспрессирующие фимбрии Mat / ECP, связанные с четырьмя очень разными гликанами в массиве, Galα1-6Glc (гликан ID 83), Asialo-G M1 (Galβ1-3GalNAcβ1-4Galβ1-4Glc; гликан ID 1F), группа крови B (Fucα1-2 (Galα1-3) Gal; гликан ID 226) и GlcNAcβ1-6Galβ1-4GlcNAc (гликан ID 253). В литературе единственными другими гликановыми мишенями, идентифицированными для фимбрий Mat / ECP, являются растительные (1 → 5) -α-связанные l-арабинозильные остатки и более длинные цепи арабинана (48). Эти структуры не присутствуют в гликановом массиве, используемом в этом исследовании, и не присутствуют у животных-хозяев, что позволяет предположить, что для правильного понимания рецепторной специфичности фимбрий Mat / ECP требуется дальнейшая работа.

    Фимбрии Yqi (также называемые адгезином I ExPEC; EA / I) представляют собой нехарактерный тип фимбрий CU, обнаруженный преимущественно в изолятах E. coli из филогруппы B2 (49), которая включает внекишечные E. coli, связанные с мочевыводящими путями, кровотоком и др. центральная нервная система и птичье происхождение. У патогенной птичьей кишечной палочки (APEC) фимбрии Yqi связаны с адгезией и колонизацией легких цыплят во время инфекции (49, 50). Здесь кластер фимбриальных генов yqi амплифицировали с помощью ПЦР из штамма UPEC CFT073, клонировали в вектор экспрессии pBAD / Myc-HisA и трансформировали в MS428 для создания штамма MS428 (pYqi).В анализе массива гликанов целые клетки MS428 (pYqi), экспрессирующие фимбрии Yqi, связаны с асимметричной двухантенарной структурой гликана (набор данных S1; гликан ID 490) с концевой β-галактозой на одной руке и β- N -ацетилглюкозамином на второй - концевой β-GlcNAc (набор данных S1; гликан ID 250), что указывает на некоторое предпочтение концевых структур β-GlcNAc. Связывание также наблюдалось с тремя фукозилированными структурами; включая Lewis A (набор данных S1; гликан ID 233), гликан группы крови B (набор данных S1; гликан ID 360) и α-Gal-Lewis X (набор данных S1; гликан ID 364).Все структуры, распознаваемые Yqi, широко экспрессируются в разных типах тканей и видах хозяев (51–53), при этом группы крови и антигены Льюиса являются общей мишенью для патогенов (54).

    Профиль связывания рецепторов двух фимбрий CU из энтеротоксигенной E. coli (ETEC), которые опосредуют адгезию к эпителиальным клеткам кишечника свиней и вносят вклад в диарею ETEC у новорожденных и поросят после отъема, был исследован с использованием нашей системы рекомбинантной экспрессии цельноклеточных гликанов. , а именно фимбрии F4ac (K88ac) и F5 (K99) (55, 56).Целые клетки MS428 (pK88-AC), экспрессирующие фимбрии F4ac, связаны с рядом α- и β-связанных концевых гликанов галактозы с предпочтением гликанов, содержащих ядро ​​Galβ1-3GlcNAc (рис. 1 и набор данных S1). Связывание с концевыми гликанами Galα1-3 фимбриями F4ac указывает на распознавание нечеловеческих гликанов, что согласуется с их ассоциацией с заболеванием (26, 27). Эти гликаны Galα1-3Galβ1-3GlcNAc обычно экспрессируются в клетках всех млекопитающих, кроме человека и старых обезьян (57). Анализ SPR определил аффинность связывания 160 нМ с α1-3-галактозой и 11.2 мкМ к asialoGM1, подтверждая наблюдение, что фимбрии F4ac взаимодействуют с высоким сродством с концевыми структурами α1-3-галактозы. К сожалению, прямое сравнение связывания F4ac и другого варианта F4 фимбрий, F4ab, не могло быть выполнено, поскольку клетки MS428 (pK88-AB) неспецифически связывались с блокированной этаноламином стеклянной поверхностью массива, тем самым препятствуя точному выявлению его профиль сродства к гликану. Целые клетки MS428 (pK99), экспрессирующие фимбрии F5, связывались только с одним гликаном на массиве, Neu5Acα2-3Galβ1-3GlcNAc (рис.1 и набор данных S1). Это обычный гликан, обнаруживаемый в желудочно-кишечном тракте и легких свиней (58, 59), и он аналогичен ранее определенному F5-взаимодействующему гликану Neu5Gcα2-3Galβ1-4Glc-церамиду (27, 60), который не присутствовал в гликане. множество. Не было обнаружено связывания с концевым дисахаридом Neu5Gcα2-3Galβ (гликановый номер 206) (фиг. 1 и набор данных S1). Взятые вместе, данные, представленные здесь, вместе с предыдущими данными в литературе, предполагают, что эти фимбрии связываются с предпочтением сиаловых кислот, содержащих α2-3 связи, но могут также связываться с N-ацетил- и N-глицилнейраминовыми кислотами, обе из них: которые присутствуют у свиней (58, 59).

    Выводы. Возможность быстрого скрининга и измерения адгезин-гликановых взаимодействий предоставляет новые возможности для понимания тропизма ткани бактерия-хозяин и создает платформу для разработки новых терапевтических средств для предотвращения бактериальной колонизации и болезней. Действительно, учитывая текущий сценарий быстрого роста устойчивости к антибиотикам, а также нехватку новых антибиотиков в разработке, такие альтернативные подходы к лечению крайне необходимы. Лучшими примерами антиадгезивных терапевтических средств являются маннозиды, высокоаффинные аналоги маннозы, которые связываются с адгезином FimH фимбрий типа 1 и уменьшают количество E.coli мочевого пузыря и толстой кишки (30, 33, 61, 62). Атомные детали, описывающие связывание производных маннозида с FimH, привели к их оптимизации для повышения активности, эффективности и пероральной биодоступности и продемонстрировали их терапевтическую эффективность на животных моделях экспериментальных ИМП (34, 63). Были также разработаны другие аналоги низкомолекулярных рецепторов с высокоаффинными галактозидами, которые блокируют опосредованное Fml фимбриями связывание E. coli с рецепторами, содержащими GalNAc в мочевыводящих путях, что также является перспективным для лечения инфекций мочевого пузыря и почек у экспериментальных мышей ( 64, 65).Описанная здесь работа представляет собой гибкую, быструю и масштабируемую систему для определения новых адгезин-гликановых взаимодействий, которые лежат в основе бактериальной колонизации и могут быть использованы для идентификации структур свинцовых гликанов для разработки новых терапевтических средств.

    МАТЕРИАЛЫ И МЕТОДЫ

    Штаммы, плазмиды и условия культивирования E. coli и плазмиды, использованные в этом исследовании, перечислены в таблице 2. Гетерологичная экспрессия специфических фимбрий была достигнута трансформацией штамма fim -отрицательный MS428 плазмидами, содержащими гены, кодирующие тип 1, P, F1C, Mat / ECP, Yqi. , F4ac (K88ac) или F5 (K99) фимбрии.Штаммы E. coli обычно культивировали при 37 ° C на твердой или жидкой среде лизогенного бульона (LB) (66) или жидкой минимальной среде M9 (42 мМ Na 2 HPO 4 , 22 мМ KH 2 PO 4 , 9 мМ NaCl, 18 мМ NH 4 Cl, 1 мМ MgSO 4 , 0,1 мМ CaCl 2 и 0,2% [вес / объем] глюкозы). При необходимости в среду добавляли ампициллин (100 мг / мл -1 ), канамицин (100 мг / мл -1 ) или хлорамфеникол (25 мг / мл -1 ).FimH LD был экспрессирован и очищен, как описано ранее (35).

    ТАБЛИЦА 2

    штаммов и плазмид E. coli, использованных в этом исследовании

    Анализ гликанового массива очищенного белка FimH. Слайды с гликановыми матрицами были напечатаны с использованием субстратов, активированных SuperEpoxy 3, как ранее описано в Waespy et al. (67). Массивы гликанов предварительно блокировали 1% бычьим сывороточным альбумином в фосфатно-солевом буфере (PBS) в течение 15 мин. Эксперименты по связыванию гликанового массива проводили с использованием 1 мкг белка FimH LD в 65 мкл и анализировали, как ранее описано в Shewell et al.(68).

    Анализ гликанового массива рекомбинантных штаммов E. coli, экспрессирующих различные фимбрии E. coli MS428, несущие плазмиды, кодирующие различные фимбрии CU, выращивали в минимальной среде M9 при 37 ° C до оптической плотности 0,5-0,6 при 600 нм (OD 600 ), в это время добавляли флуоресцентную метку TR метилового эфира Bodipy при конечная концентрация 20 мкМ. Мечение проводили, инкубируя клетки при 37 ° C в темноте при осторожном встряхивании в течение 60 мин.

    Массивы гликанов были получены, как описано ранее (67, 69), и применены к массивам, как описано в Wurpel et al.(70). Всего 500 мкл меченой бактериальной смеси добавляли к 65 мкл генной рамки в виде пузырька и оставляли для инкубации в темноте в течение 20 мин. Предметные стекла трижды промывали PBS и фиксировали 4% формальдегидом перед центрифугированием. Слайды сканировали и анализировали, как описано ранее (68) и как указано в таблице соответствия MIRAGE (см. Таблицу S1 в дополнительном материале).

    SPR-анализ бактериальных фимбриальных белков. Взаимодействия между белком FimH LD и маннозными гликанами анализировали с использованием поверхностного плазмонного резонанса (SPR), как описано Shewell et al.(68) со следующими модификациями. Белки иммобилизовали на чипе CM5 при pH 4,0 и скорости потока 5 мкл / мин в течение 600 с, используя контрольную проточную кювету с этаноламином в качестве контроля. Гликаны были протестированы в диапазоне от 1,6 нМ до 1 мкМ. Из всех данных вычитали двойную ссылку. SPR целых бактерий выполняли с использованием системы Biacore T200 и сенсорных чипов серии S (GE Healthcare Life Sciences), как описано ранее (40). Все проточные кюветы (от 1 до 4) были подготовлены для иммобилизации в соответствии с инструкциями производителя, и бактерии протекали при OD 600 , равном 0.2 в ацетатном буфере с pH 5,0 и иммобилизовали при скорости потока 5 мл / мин в течение 720 с. MS428 был иммобилизован на проточной кювете 1 в качестве отрицательного контроля. Гликан пропускали через гликаны от 1,6 нМ до 100 мкМ с использованием одноцикловой кинетики. Константу диссоциации ( K D ) взаимодействий получали с использованием пакета программ оценки Biacore T200 (GE Healthcare Life Sciences).

    Официальное голосование

    - самая крутая вещь, сделанная в Северной Каролине

    Bigjasters 9077 Чеддер Бо Бисквит Cocor773 Носки от Farm to Feet Носки Maschinenfeld 9077 Носки Maschinen 9075 Hippola Co.Оригинальная гранола 9077 Контейнер для прыжков с парашютом Knda 9077 Изготовленные на заказ титановые велосипеды Пляжные жевательные конфеты Hansears Рэй Миллер
    Гнездо для протезов Additive America
    Agility Fuel Solutions Топливные системы ProCab® CNG
    Allura USA's Fiber Cement Plank in Traditional Pattern
    Artisan Leaf Табачные листы ручной работы и поверхности
    Целебная бальзам с ромашкой и лавандой Benevolence Farm
    Bertie County Peanuts Морская соль и черный перец 9077 Ложка для орехов
    Bojangles Spicy Cajun Fried Chicken
    Посудомоечная машина Bosch из нержавеющей стали SHX88PZ55N
    Butterfields Peach Buds
    Medical Free Creek Creek 9075 Гарнитура ycle
    Capel Rugs
    Компактный гусеничный погрузчик Cat® 299D3 XE
    Chad's Original Black Chai
    Cheerwine
    Cheerwine
    Кри | Карбид кремния от Wolfspeed
    Экскакаторы Deere Hitachi
    Стеновая палатка Hestia от Diamond Brand
    Elizabeth's Pecans
    Соус барбекю Джорджа
    Пипетки Greiner Bio-One (GBO)
    Gulo Composites GME-30 Enduro Wheelset
    Hickory Nut Gap Копченый бекон
    гостеприимные монетные дворы
    Дезинфицирующее средство Hydromer First Responder
    Jarrett Bay Boatworks Полупродукция 34
    Javelin Odyssey Skydiving Ткань для рук
    Krispy Kreme Donuts
    Ludwig Drums
    Luv N Mountain Soaps от Vera
    Luwa Air Wash
    Moog One 9077 Moog One 9077Olive Pickles
    Nugget Kids Couch
    Спортивная спортивная форма OT
    Pepsi
    Piedmont Candy Company’s Peppermint Red Bird Candy Puffs.
    Power Curber серии 5700 Slipform Machine
    Precision Time Timekeeper
    Матрас и подушки ProMagnet
    Ripe Revival Protein Gummies
    Southern Supreme Fruitcakes
    Расширяемый трейлер и тур по программе Be Proud Workforce Education SPEVCO
    Spirit AeroSystems Airbus A350 XWB Композитные секции для самолетов
    SylvanSport GO Camper Texas Pete Hot Sauce
    The Cheesecake Factory Cheesecakes
    The Heritage Flag Company's Old Glory Full Barrel
    HondaJet Elite
    Медные абажуры и лампы Rustic Lamp 90 5
    Двухстенная духовка Thermador PODS302W
    Thomas Built Buses Электрический автобус Saf-T-Liner® C2 Jouley ™.
    Thundersticke German Alt Beer
    Tony's Ice cream Vanilla Milk Shakes
    Футболки TS Designs
    Vick's Vaporub

    IJMS | Бесплатный полнотекстовый | Опосредованная гликозаминогликанами передача сигналов о связывании CXCL8 с эндотелиальными клетками

    1. Введение

    Взаимодействие между лейкоцитами и поверхностью эндотелиальных клеток является ключевым событием в воспалительных процессах.Гликозаминогликаны (ГАГ) на поверхности эндотелиальных клеток являются решающими медиаторами этого взаимодействия [1]. Это семейство неразветвленных полисахаридов обнаружено во всех клетках человека, а также во внеклеточном матриксе и состоит из шести различных членов, гепарина (HP), гепарансульфата (HS), хондроитинсульфата (CS), дерматансульфата (DS), кератана. сульфат (KS) и гиалуроновая кислота (HA), которые различаются по строительным блокам дисахаридов. Наиболее распространенными ГАГ на клеточной поверхности являются HS и CS.HS состоит из повторяющихся единиц -d-GlcA-β- (1 → 4) -d-GlcNAc-α- (1 → 4) - с переменной степенью N-деацетилирования / N-сульфатирования, O-сульфатирования и C5-. эпимеризация; CS состоит из повторяющихся единиц -d-GlcA-β- (1 → 3) -d-GalNAc-β- (1 → 4) - единиц, которые могут быть изменены с помощью 2-O, 4-O, 6-O. -сульфаты и эпимеризация. Уникальный структурный дизайн, который, в свою очередь, определяет специфические свойства связывания белков, создается во время биосинтеза за счет согласованного действия сложного набора ферментов [2,3]. Во время удлинения цепи возникающая цепь GAG модифицируется эпимеразой, превращая GlcA в IdoA, а несколько сульфотрансфераз добавляют сульфатные группы в различные положения.Для удлинения и модификации цепи требуется набор различных ферментов для путей HS и CS. Зрелая цепь HS также может редактироваться под действием эндосульфатаз и гепараназы. В частности, ферменты, участвующие в формировании структуры сульфатирования, существуют в нескольких изоформах с различными активностями, специфичностями субстрата и распределением в тканях. Следовательно, модуляция в структуре GAG, вероятно, будет достигнута, по крайней мере, до некоторой степени, путем дифференциальной регуляции экспрессии определенного набора модифицирующих ферментов.Оба класса GAG, HS и CS, ковалентно присоединены (O-связаны) к коровым белкам, образуя так называемые протеогликаны (PG) семейства синдеканов (SDC) и глипиканов (GPC) [4,5]. В то время как GPCs связаны с мембраной через C-концевые гликозилфосфатидилинозитоловые якоря, SDC являются единственными трансмембранными HS протеогликанами [6,7]. У млекопитающих экспрессируются четыре изоформы SDC (SDC 1–4) в зависимости от типа клеток, ткани и заболевания [8,9,10]. Все внеклеточные домены SDC несут по крайней мере три цепи HS рядом с их N-концом, но в некоторой степени также CS прикрепляется к сайтам, более близким к клеточной мембране [6,11,12].Компоненты белкового ядра PG синтезируются в рибосомах, которые затем перемещаются в грубый ER, где ксилозилтрансфераза инициирует синтез линкерного тетрасахарида, добавляя ксилозу к остатку серина в ядре белка. Затем два остатка галактозы добавляются в цис- или медиальном отделе Гольджи к Xyl с помощью галактозилтрансферазы I и галактозилтрансферазы II. Четвертый остаток, завершающий линкерный тетрассахарид, представляет собой GlcA, добавленный глюкуронилтрансферазой I, и находится в транс-Гольджи, конечном месте для всех последующих реакций.Добавление пятого сахарида определяет, станет ли цепь GAG хондроитинсульфатом (CS) / DS или HS / гепарином. Тип GAG, длина цепи (цепей), конформационная гибкость и, в частности, конкретная последовательность / структура GAG определяют биологическую функцию гликановой части PG. Структурные особенности этих цепей GAG позволяют SDC взаимодействовать с множеством растворимых и нерастворимые молекулы, включая факторы роста [13,14], хемокины [15,16,17], молекулы внеклеточного матрикса [18,19], факторы свертывания крови [20,21] и белки, участвующие в метаболизме липидов [22,23,24].Подсчитано, что ГАГ могут связываться с несколькими сотнями белков [25,26,27]. Взаимодействие ГАГ-белок может приводить к защите от протеолиза [28,29], опосредованию и изменениям белок-белковых взаимодействий [30,31,32,33] и презентации белка на поверхности эндотелиальных клеток [34,35]. Учитывая их взаимодействие с огромным количеством белков, а также их множественное воздействие на эти белки, неудивительно, что ГАГ участвуют в большом количестве физиологических событий и злокачественных новообразований. CXCL8 является членом семейства белков хемокинов, которые включает небольшие, обычно основные хемотаксические белки.Этот хемокин участвует во многих патофизиологических состояниях, включая рак [36], хроническую обструктивную болезнь легких (ХОБЛ) [37] и ревматоидные заболевания [38]. Это хорошо известный GAG-связывающий белок, который отвечает за привлечение нейтрофилов к месту воспаления путем активации хемокиновых рецепторов CXCR1 и CXCR2 [39]. Активация этих рецепторов, связанных с G-белком, приводит к механизмам активации клеток, опосредованным MAPK, таким как миграция клеток, прикрепление клеток и дегрануляция [40].GAG, такие как HS, которые являются неотъемлемой частью протеогликанов клеточной поверхности (HSPG), способствуют образованию твердофазных градиентов CXCL-8 на эндотелиальных поверхностях, что имеет центральное значение в многоступенчатом процессе адгезии лейкоцитов и эндотелиальной трансмиграции [41]. , 42,43]. Помимо CXCR1 и CXCR2, CXCL8 связывается с DARC, несигнальным хемокиновым рецептором [44,45]. До сих пор не исследовалось, приводит ли связывание CXCL8 с HSPG на клеточной поверхности к внутриклеточной передаче сигналов в эндотелиальных клетках воспаленных тканей. .Мы проверили эту гипотезу, исследуя, во-первых, дифференциальную экспрессию гена HSPG после стимуляции TNFα, а во-вторых, протеомный анализ экспрессии белка после инкубации CXCL8 предварительно стимулированных TNFα эндотелиальных клеток микрососудов человека. Изменение формы гликокаликса за счет выделения протеогликанового эктодомена [46,47,48] и активности гепараназы [49,50], которые играют важную роль in vivo, моделировались обработкой хондроитиназой ABC и гепариназой III. Мы нашли доказательства того, что CXCL8-индуцированная передача сигналов через GAG происходит в эндотелиальных клетках и что это влияет на экспрессию белков, которые участвуют в клеточной адгезии и подвижности клеток.

    3. Материалы и методы

    3.1. Культура клеток
    Эндотелиальные клетки микрососудов легких человека (HMVEC-1, Lonza, Базель, Швейцария) в четвертом пассаже выращивали до 80% слияния в колбах T75 (Greiner Bio-One, Кремсмюнстер, Австрия), содержащих 10 мл базальной эндотелиальной среды и ростовой среды. добавки (Lonza). При необходимости рекомбинантный TNFα (Sigma-Aldrich, Сент-Луис, Миссури, США) добавляли до конечной концентрации 50 нг / мл и инкубировали в течение 10 ч при 37 ° C и 5% pCO 2 .Время инкубации и дозировка TNFα были недавно оптимизированы в наших лабораториях [69]. При необходимости в культуральную среду добавляли гепариназу III (0,1 мЕд / мл, Iduron, Alderley, UK) и хондроитиназу ABC (0,5 мЕд / мл, Sigma-Aldrich) после 30 мин инкубации с TNFα. Чтобы исключить передачу сигнала CXCL-8 через CXCR1 и CXCR2 и связывание с DARC / D6, добавляли 0,5 мкг / мл каждого антитела против CXCR1, анти-CXCR2 и анти-DARC / D6 (Санта-Крус, Даллас, Техас, США). к среде. После инкубации в течение 90 минут к среде добавляли рекомбинантный CXCL-8 (Antagonis Biotherapeutics GesmbH, Грац, Австрия) до конечной концентрации 50 нМ.После инкубации в течение 8 ч клетки дважды промывали PBS, соскребали в 2 мл PBS / EDTA и центрифугировали в пробирке Эппендорфа на 2 мл при 500 × g. Остаточные клетки в планшете собирали 2 мл PBS / EDTA, добавляли к осадку клеток и снова центрифугировали при 500 × g. Супернатанты удаляли, а осадки клеток хранили при -80 ° C до дальнейшего использования.
    3.2. Выделение цельной РНК

    Полную РНК выделяли из клеток с использованием набора для выделения общей РНК (Sigma-Aldrich) в соответствии с протоколом производителя.Качество и количество выделенной РНК определяли фотометрически при 260 и 280 нм и с помощью биоанализатора.

    3.3. Анализ экспрессии генов

    Экспрессию генов исследовали с использованием системы GeneChip ® Gene 1.0 ST Array (Affymetrix, Санта-Клара, Калифорния, США). Синтез кДНК из цельной РНК, фрагментацию и мечение проводили согласно протоколу Affymetrix ® GeneChip ® Whole Transcript (WT) Sense Target Labeling Assay Rev 5.Для гибридизации использовали набор для гибридизации, промывки и окрашивания GeneChip ® в соответствии с протоколом производителя на Fluidics Station 450. Для сканирования использовались сканер Affymetrix GCS3000 и программное обеспечение AGCC Command Console AGCC_3_1_1. Консоль Affymetrix Geneexpression версии 1.1. был использован для оценки качества. Обработка и фильтрация данных производились с помощью программного обеспечения Partek v 6.4. Для надежного многочипового анализа, коррекции фона, квантильной нормализации для всех чипов в эксперименте было выполнено преобразование log2 и обобщение медианы полировки.Дифференциально экспрессируемые гены идентифицировали с помощью парного t-критерия с использованием p-значения 0,05 и порога кратного изменения 1,3.

    3.4. Выделение и маркировка белка
    Осадки

    клеток (приблизительно 6 × 10 6 клеток) лизировали в 75-100 мкл 30 мМ трис-HCl, 9 М мочевины, 4% CHAPS (мас. / Об.), PH 8,5. Солюбилизацию усиливали двумя короткими инкубациями в бане для обработки ультразвуком в течение примерно 20 с каждая с периодическим охлаждением образца до 5 ° C и одним циклом замораживания-оттаивания. Содержание белка определяли с помощью анализа связывания белка Coomassie G-250.Аликвоты белка по 25 мкг трижды метили 200 пмоль минимальных красителей CyDyes (GE Healthcare Life Sciences, Little Chalfont, UK) в соответствии с протоколом производителя. Обратное мечение с помощью Cy3 и Cy5 было выполнено для всех образцов, чтобы исключить предпочтительное мечение. Cy2 использовали для внутреннего стандарта (пул всех образцов в одном эксперименте), который был включен во все гели.

    3.5. 2D-электрофорез
    Классический 2D-электрофорез выполняли, как было опубликовано ранее [70].Образцы анодно наносили на регидратированные лабораторные нелинейные IPG с pH от 4 до 10 длиной 12 см и прогоняли в системе Multiphor (GE Healthcare, Little Chalfont, UK) при 20 кВ / ч. После одномерного разделения полоски замораживали до дальнейшего использования. Для второго измерения полоски уравновешивали и переносили в гель SDS-PAGE (T = 10-15% линейный градиент, C = 2,7%) по Лэммли в вертикальной камере для электрофореза Hoefer SE 600 (Hoefer Scientific Instruments, Holliston, Массачусетс, США).После 2DE гели сканировали на тепловизоре Typhoon 9400 и оценивали с помощью DeCyder Software V5.02 (оба GE Healthcare). Рассчитывали соотношения между объемами единичных пятен в образцах и соответствующих пятен во внутреннем стандарте. Статистические характеристики в DeCyder использовались для оценки гелей 2-DE. Белковые пятна, по-разному экспрессируемые в разных образцах, экстрагировали из отдельных окрашенных серебром гелей с использованием объемных соотношений 1,5 в качестве критериев отбора. Для обнаружения использовали модифицированный протокол окрашивания серебром по Heukeshoven [68].Гели сканировали с помощью планшетного сканера Sharp JX-330. Дифференциально регулируемые пятна вырезали для масс-спектрометрии.
    3,6. Масс-спектрометрия
    Триптическое расщепление в геле, экстракция пептидов и нано-ВЭЖХ. МС 2 выполняли, как описано ранее [71]. Анализ спектров MS 2 в отношении идентичности пептидов обычно выполняли с применением поисковых систем как GPM (Global Proteome Machine Organization), так и SEQUEST (Thermo Finnigan, Waltham, MA, USA).В общем, пептид был надежно идентифицирован только в том случае, если индивидуальные оценки XCorr пептидов были ≥2 для однозарядных, ≥2,5 для двухзарядных и ≥3,5 для трехзарядных пептидов для SEQUEST и если logE было ≤-2,5 для GPM. Пептиды с оценкой logE от -1,5 до -2,5 включали только в том случае, если ряды ионов b и y соответствующего фрагмента показали полноту не менее 80%. Учитывались только белки, идентифицированные обеими поисковыми системами. Все пептиды были проверены на базе данных UniProt Knowledgebase.
    3,7. RT-qPCR

    2 мкг выделенной РНК цельной клетки подвергали обратной транскрипции в кДНК с использованием набора для обратной транскрипции кДНК High Capacity (Applied Biosystems, Foster City, CA, USA) в соответствии с протоколом производителя. Для реакции qPCR использовали Power SYBR Green PCR MasterMix в соответствии с протоколом производителя. Глицериндегид-3-фосфат-дегидрогеназа (GAPDH) была выбрана в качестве эталонного гена домашнего хозяйства. Были использованы следующие праймеры синдекана: Синдекан-1 (5′-AGGATGGAACTGCCAATCAG; 3′-ATCCGGTACAGCATGAAAGC), Синдекан-2 (5′-TCTGAGGCAGAAGAGAAGCTG; 3′-AGGATGAGGATGATGATGGCAAACTGGGAGTCGACTGGACTGACGTCGCAGTCGGACGTCGCGTCGCGTCGCGTCGCGTCGGACGTCGGACGTGGAGTCGCGGTCGACGTCGCGTGA , Синдекан-4 (5'-AACCACATCCCTGAGAATGC; 3'-AGGAAAACGGCAAAGAGGAT).Термоцикл и обнаружение сигнала выполняли в системе Applied Biosystems 7300 Real Time PCR System. Термоцикл состоял из начальной стадии денатурации (10 мин при 95 ° C), за которой следовали 40 циклов денатурации (15 с при 95 ° C), отжиг праймера (30 с при 60 ° C) и удлинение (1 мин при 72 ° С). В конце был добавлен один заключительный этап диссоциации (по умолчанию в системе). Для визуализации и анализа данных использовалось программное обеспечение SDS системы 7000 (Applied Biosystems, V 1.2.3). Был выбран автоматический порог Ct и автоматическая коррекция базовой линии.

    3.8. Проточная цитометрия

    Экспрессию синдекана на клеточной поверхности определяли с помощью проточной цитометрии. HMVEC (Lonza). Клетки высевали в 6-луночные планшеты (GBO, Кремсмюнстер, Австрия), оставляли без обработки или стимулировали 50 нг / мл TNFα (PeproTech, Rocky Hill, NJ, USA) в течение 4 ч при 37 ° C / 5% CO 2 , промывали PBS, отделяли с помощью PBS / 5 мМ EDTA в течение 20 минут при 37 ° C / 5% CO 2 и переносили в пробирку для FACS (Becton Dickinson, Franklin Lakes, NJ, USA).

    Образцы затем инкубировали с 0.25 мкг / мл соответствующего флуорофор-связанного антитела (моноклонального антитела против человеческого синдекан-4-аллофикоцианина) от R&D Systems (Миннеаполис, Миннесота, США) в течение 30 минут при 4 ° C. Изотипический контроль выполняли с использованием 0,25 мкг / мл антитела APC Rat IgG2a IC (Becton Dickinson) при тех же условиях мечения. После инкубации образцы промывали и фиксировали, используя BD Cellfix Buffer ™ (Becton Dickinson). Данные были получены с использованием FACS Calibur (Becton Dickinson) с программным обеспечением CellQuest ™ (Becton Dickinson). Анализ проводился с помощью FlowJo v7.6.5 (Treestar, Ashland, OR, США).

    3.9. Кластеризация функциональных аннотаций
    DAVID Functional Annotation Tool v6.8 [1] использовался для определения общих характеристик белков. Инструмент выполняет аннотацию терминов GO, функции белков, местоположения белков и т. Д., Вычисляет статистические значения и группирует белки в значимые группы. Вводили образцы дифференциально экспрессируемых белков в UniProt и выполняли кластеризацию функциональной аннотации на фоне гена Homo sapiens с использованием параметров по умолчанию.Далее был проанализирован пять наиболее значимых кластеров. См. Дополнительные материалы для полных аннотаций и данных кластеризации.

    4. Выводы

    Полученные данные показали, что CXCL8-GAG-взаимодействия являются более сложными, чем принято считать. Трансмембранные протеогликаны, которые частично показали повышенную экспрессию при воспалении, по-видимому, не только способствуют хемотаксическому градиенту, но также трансдуцируют опосредованные CXCL8 сигналы в клетки-мишени. CXCL8-опосредованная реорганизация актинового цитоскелета, независимая от обычных путей CXCR1 и CXCR2, может иметь значение в сложном процессе воспаления.Мы обнаружили, что лечение воспаленного TNFα HMVEC экзогенным CXCL8 было связано с перестройкой экспрессии белков цитоскелета, особенно после лечения гепариназой и хондроитиназой ABC. Изменение формы HS и CS с помощью этих ферментов в гликокаликсе приводит к усилению изменений в экспрессии белка. Это подчеркивает данные о том, что ГАГ играют жизненно важную роль в передаче сигналов хемокинов, например, связывая белки с клеточной поверхностью и опосредуя взаимодействия хемокинов с другими белками.Считается, что изменение слоя GAG на поверхности эндотелиальных клеток является важным механизмом воспалительных процессов in vivo. Обычно цепи GAG выходят во внеклеточное окружение дальше, чем обычные рецепторы адгезии нейтрофилов. Известно, что общие триггеры воспаления, такие как TNFα и IL-1, регулируют экспрессию MMP, участвующих в изменении формы гликокаликса, а также в отрыве эктодомена SDC.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *